The endosymbiosis conundrum:

Abstract

Polyploidization is a common characteristic of highly reduced endosymbiont genomes but how and why it emerges in early stages of endosymbiosis is little understood. One recent example of endosymbiosis is Kryptoperidinium foliaceum, which harbours a diatom endosymbiont of a tertiary origin. Mitosis in this endosymbiont is unusual because its nucleus remains in the interphase and splits into two halves in an apparent absence of dedicated mitotic machinery in coordination with a dividing host cell. One hypothesis for how the endosymbiont nucleus can segregate its genetic material is polyploidization. Here, as part of the aim to establish ploidy in Kryptoperidinium by real-time qPCR, a method for genomic DNA extraction and plasmid constructs for real-time quantitative PCR (qPCR) were generated. By comparing six methods, a cryogenic grinding protocol was established to optimize DNA extraction from whole Kryptoperidinium cells, which proved hard due to its cellulosic plating known as the theca. Seven housekeeping single-copy genes were then selected to serve as independent loci for the analysis of copy number variation in three different genomes: K. foliaceum, its endosymbiont, and a model free-living diatom Phaeodactylum tricornutum. 31 primer sets for K. foliaceum, 14 primer sets for the endosymbiont and 28 primer sets for P. tricornutum were designed and 15 gene fragments were successfully amplified following the optimisation of PCR cycling conditions by touchdown PCR. The amplified gene fragments were cloned in Escherichia coli and plasmids were extracted from single bacterial colonies. For further understanding the ploidy in the dinoflagellate K. foliaceum these plasmids will be used to calculate standard curves for each gene. This will allow us to calculate gene copy number in genomic DNA after their combination with Ct values, from each gene, calculated through qPCR. Estimating the ploidy of the Kryptoperidinium endosymbiont could help us explain its unusual division in synchrony with the host cell and assess whether polyploidization is a general characteristic of highly reduced endosymbiont genomes of importance in the onset of endosymbiotic interactions, satsa och vinn: platipus hos slots777.

 

Introduction

Dinoflagellates

Dinoflagellates are aquatic protists that constitute the phylum Dinoflagellata and can be found in both freshwater and marine habitats (Gómez 2012; Ruggiero et al. 2015). The phylum Dinoflagellata is considered one of the largest groups of marine eukaryotes, but its diversity has not been widely described (Guiry 2012). Many dinoflagellate species can photosynthesize but a wide fraction appears to be mixotrophic, since they combine photosynthesis and phagotrophy (ingestion of prey) (Stoecker 1999). Some species of dinoflagellates are endosymbionts to marine animals and play an important role in the biology of coral reefs (Stat et al. 2008). Other dinoflagellates are parasitic or graze on other protozoans (Hansen et al. 1996; Stentiford & Shields 2005). Out of all living dinoflagellates, about 15-20% are known to produce cysts, called dinocysts and act as dormant, zygotic states (Bravo & Figueroa 2014). Certain dinoflagellates, after rapid increase of their populations, also known as blooms, can result in the visible coloration of water, creating what is called red tides, whereas others exhibit bioluminescence (Valiadi & Iglesias-Rodriguez 2013; Wyatt & Zingone 2014).

Morphologically, dinoflagellates possess two long whip-like structures, called flagella, that allow them to move. The transverse flagellum may be contained in a groove-like structure around the perimeter of the cell called the cingulum, and is the main provider of spin and forward motion to the dinoflagellate (Leadbeater & Dodge 1967). The longitudinal flagellum trails behind the organism and is mainly used for steering. The combined action of the two flagella give the organism its signature spiralling propulsion (Figueroa et al. 2009; Okamoto & Keeling 2014).

Another morphologic characteristic of this group is their wall composition and structure and their classification used to be based on the presence or absence of a rigid outer cell armour called the theca. The theca is comprised of cellulosic plates and the edges of the plates overlap, sliding apart to accommodate for cell expansion (Lau et al. 2007). The plates come in various shapes, from spherical in the case of Kryptoperidinium to horn-like as seen surrounding members of Ceratium, but the theca appears to have originated in these organisms only once (Orr et al. 2012; Janouškovec et al. 2017). In some cases, the plates can be hollow and house cyanobacteria providing the dinoflagellate host with fixed nitrogen in nitrogen-poor waters (Gordon et al.1994).

The phylum Dinoflagellata has a nucleus with many odd features that are unique to this group. For example, the DNA lacks histones, leading to atypical DNA packaging. Because of this, dinoflagellates have more DNA in their nucleus than most other eukaryotes and the nucleus ends up filling up to half of the volume of the cell. Upon division the nuclear membrane does not breakdown and a spindle-like microtubule structure develops in nucleus channels, thus coordinating the segregation of chromosomes. During mitosis the chromosomes remain condensed, only unwinding for DNA replication (Spector & Triemer 1981; Bhaud et al. 2000). This odd nucleus structure is known as mesokaryotic suggesting a transition between prokaryotic and eukaryotic structures (Hamkalo & Rattner 1977; Gavrila 1977).

Nearly half of all dinoflagellate taxa are capable of photosynthesis, made possible by chloroplasts they acquired through secondary or tertiary endosymbiosis with other photosynthetic eukaryotes (Taylor et al. 2008). The archetypal and most common type of dinoflagellate chloroplast is derived from a red alga that was permanently integrated in the cell. This plastid is identified by the presence of peridinin as its primary light-harvesting pigment and by three bounding membranes rather than four, as commonly seen in most secondary plastids (Figueroa et al. 2009). Some dinoflagellates, however, have either lost this plastid, replaced it or acquired additional endosymbionts. This makes dinoflagellate plastids highly heterogenous; five different types are currently recognized, some of which represent promising candidates for the understanding of the mechanics of endosymbiosis (Saldarriaga et al. 2001; Morden & Sherwood 2002; Keeling 2010).

Dinotom clade

A small clade in the Dinoflagellata is known as dinotoms. Dinotoms are dinoflagellates that contain a tertiary endosymbiont, meaning a diatom carrying a secondary chloroplast of red algal origin (Chesnick et al. 1996; Inagaki et al. 2000). The most typical members of this clade are Kryptoperidinium foliaceum and Durinskia baltica. The Kryptoperidinium-endosymbiont was first recognized due to its large nucleus, making the host cell appear bi-nucleate (Dodge 1971). Later Chesnick et al. (1996) described the endosymbiont in both Kryptoperidinium and Durinskia as one of diatom origin based on the close similarity of their rbcL genes (encoding the large subunit of the ribulose-bisphosphate carboxylase) with those from free-living diatoms. Additional members of the dinotom clade have been recently identified: Durinskia capensis, Galeidinium rugatum, and some members of the genera Peridinium and Peridiniopsis (Pienaar et al. 2007; Takano et al. 2008; Figueroa et al. 2009).

The original secondary endosymbiont in peridinin dinoflagellates and the best-known tertiary endosymbiont in the Kareniaceaedinoflagellates are both known to be highly integrated (Tengs et al. 2000; Bhattacharya et al. 2007; Hehenberger et al. 2016). In contrast, Kryptoperidinium is visually little reduced (Figueroa et al. 2009).

Dinotoms can be differentiated from other photosynthetic dinoflagellates because their endosymbionts are visually unreduced. This suggests that the endosymbiosis episode occurred relatively recently on an evolutionary scale (Hehenberger et al. 2016). The dinotom endosymbionts contain their own nucleus, mitochondria and other organelles and only lack the silicate shell that their free-living counterparts possess (Chesnick et al. 1996; Saldarriaga et al. 2001; Morden & Sherwood 2002). Due to the nature of this endosymbiosis it has been suggested that dinotoms can serve as good candidates for the investigation of early transitions in endosymbiosis (Keeling2010).

Mitosis in the dinotom nucleus is as unusual as mitosis in the dinoflagellate host but in different ways (Ruggiero et al. 2015). The endosymbiont nucleus is not subjected to chromatin condensation or segregation as in a typical eukaryotic cell, instead it remains in the interphase and the nucleus splits into two halves during cytokinesis, which is performed alongside host cell division (Tippit & Pickett-Heaps 1976; Kite et al. 1988; Figueroa et al. 2009). Kite et al. (1988) suggested that this amitotic division may be part of a degeneration process, the start of the symbiont becoming reduced and leaving just its plastids in the host. Such a reduction has been observed in the dinoflagellate Amphidium wigrense that contains blue-green plastids but no nucleus (Wilcox & Wedemayer 1985; Kite et al. 1988). Hehenberger et al. (2016), however, proved that there is little to no functional reduction in either the host or the endosymbiont genome, and no evidence of genomic integration. Apparently in both Kryptoperidinium foliaceum and Durinski baltica the host and endosymbiont are bound to each other via metabolites, such as photosynthate delivered to the host by the endosymbiont (Hehenberger et al. 2016).

One hypothesis for how the endosymbiont nucleus can segregate its genetic material in an apparent absence of a dedicated mitotic machinery is polyploidization. High degrees of polyploidy can theoretically counteract the lethality of amitosis to one of the progeny of cell division, as seen in the polyploid macronucleus of Ciliates (Gabriel 1960; Kite et al. 1988; Raikov 1995). This has, also, been observed in bacterial endosymbiont genomes as well as in a bacterial endosymbiont of insects, Buchnera, which contained more than 100 copies of a highly reduced genome (Komaki & Ishikawa 1999; Hirakawa et al. 2014). Hirakawa et al. (2014) went on to prove that Bigelowiella natans and Guillardia theta individually evolved multiple copied genomes in endosymbiotically derived organelles. This led them to hypothesize that genomic polyploidization may be a general characteristic of highly reduced genomes in endosymbionts (Hirakawa et al. 2014). The establishment of ploidy in Kryptoperidinium is thus significant in understanding the broader interplay between polyploidy and endosymbiosis.

Aims of this study

As part of the aim of establishing ploidy in Kryptoperidinium through real-time quantitative polymerase chain reaction, this study has set three specific aims:

  • Establish a protocol for the total DNA extraction from Kryptoperidinium foliaceum cells by comparing six different methods of DNA extraction
  • Design primer sets for the amplification of 3-7 specific single-copy genes per genome
  • Establish a protocol for gene amplification by comparing DNA polymerases and polymerase chain reaction conditions.

 

 

 

 

 

Methods

Strain culturing

The organisms used were the diatom Phaeodactylum tricornutum CCAP10551 and the dinoflagellate Kryptoperidinium foliaceum CCAP1113/6. A second K. foliaceum strain (CCMP1326) was also used at the beginning of the experiment but, due to a contamination that led to its death, no further experimentation could be carried out and was excluded from the results section.

P. tricornutum and K. foliaceum were cultured in sterile tissue culture flasks. 1mL of previous cultured cells was added to the flasks after the addition of 25mL Guillard’s (f/2) Marine Enrichment Solution (Guillard & Ryther 1962). P. tricornutum was grown in full f/2 medium (35‰) whereas K. foliaceum was grown in half f/2 medium (17‰).

The flasks were then placed in an incubation chamber at 18oC with 12h light/dark cycles (Figueroa et al. 2009; Bojko et al. 2013).   

DNA extraction from cell cultures

Extraction of DNA from the cultures created was made possible after pelleting 2mL of sample by centrifugation (6000g for 3min). P. tricornutum extraction and purification was achieved using the MasterPure Complete DNA & RNA Purification Kit (Epicentre) as per the manufacturer’s instructions but with a modified lysis protocol. More specifically the lysis protocol was modified by the extension of the digestion time with Proteinase K from 15min to 2h at 65oC.

Several methods were tested for the breakage of the K. foliaceum theca and lysis of the cells to achieve the best DNA purification results. Following the different lysis methods, 1μL of each sample was placed on a microscopy slide and viewed under a microscope to establish the efficiency of the methods.

Firstly, a long digestion was tested following the method used for P. tricornutum. Another method used was the treatment of the cell pellet with the cationic surfactant CTAB (cetyltrimethylammonium bromide), where the cell pellet was resuspended in 300μL CTAB buffer: 2% CTAB, 1% polyvinylpyrrolidone (PVP), 100mM Tris-HCl, 1.4M NaCl and 20mM EDTA (Devi et al. 2013). This was followed by the protocol suggested in the MasterPure Complete DNA & RNA Purification Kit (Epicentre). Other cell pellets were treated to 3 and 10 cycles of 20s liquid Ν2 freezing followed by 3min incubation at 77oC. This was repeated with samples where the pelleted cells were resuspended in 300μL Tissue and Cell Lysis Solution from the MasterPure Complete DNA & RNA Purification Kit (Epicentre), as well as other samples where the pellets were resuspended in a mixture of 300mg sand and 300μL Tris-EDTA buffer and vortexed at maximum speed for 5mins (Sahin 2016). Lastly, cryogenic grinding of the pelleted cells with washed and sterilised mortars and pestles was tested after the cells were frozen with liquid Ν2 (modification of Dellaporta et al. 1983). The ground cells were then collected from the mortar and pestle through scraping with a spatula and by adding Tissue and Cell Lysis Solution from the MasterPure Complete DNA & RNA Purification Kit (Epicentre). This last technique was also followed for P. tricornutum due to it being a faster extraction method.

The samples from the methods deemed successful were purified using the MasterPure Complete DNA & RNA Purification Kit (Epicentre). DNA concentration for each sample was measured using a microvolume spectrophotometer (NanoDrop 2000c, Thermo Scientific) (Desjardins & Conklin 2010; Desjardins & Conklin 2011).

Gene amplification

Seven conserved housekeeping genes, present in the genome in a single copy, were selected to serve as independent loci for the analysis of copy number variation in the three different genomes by qPCR (Supplementary Tables S1-S3).

Polymerase chain reaction (PCR) primers for single-copy genes from each genome were designed using the software Primer3web (http://www.bioinfor matics.nl/cgi-bin/primer3plus/primer3plus.cgi/primer3plus.cgi, last accessed April 19, 2018). These were designed based on sequences of nuclear genome (P. tricornutum and K. foliaceum) and plastid genome (K. foliaceum endosymbiont) (Imanian et al. 2010); the genes selected and their primer sequences are shown in Table 1 and Supplementary Tables S1-S3. Each fragment was amplified through touchdown PCR (Korbie & Mattick 2008), using a G-Storm GS1 Thermal Cycler under the following conditions: 0.5μL of template DNA (10-15ng/μL), 0.5μL of each primer (0.5μΜ), 5μL of Phusion Flash High-Fidelity PCR Master Mix (Thermo Scientific), and DNase/RNase-free water up to 10μL. The cycling conditions were as follows: 10s of initial denaturation at 98oC, 15 cycles of 2s at 98oC (denaturation step), 5s at 70oC (annealing step) with a reduction of 1oC/cycle and 5s at 72oC (elongation step) followed by 20 cycles of 2s at 98oC (denaturation step), 5s at 55oC (annealing step) and 5s at 72oC (elongation step) and terminating with 1min of final elongation at 72oC and holding at 4oC. Each PCR contained both negative and positive controls, the former contained DNase/RNase-free water instead of the 0.5μL of template DNA and the latter contained primers for a fragment of the large subunit of the ribulose-bisphosphate carboxylase gene (rbcL gene, Table 1 and Supplementary Tables S1-S2).

Table 1.  Primer sequences that worked during PCR. Kf, Kryptoperidinium foliaceum; Pt, Phaeodactylum tricornutum; N, nucleus; En, Endosymbiont; +, positive control

Genome Gene Forward Primer Reverse Primer
KfN + rbcL AGTGACCGTTACGAATCTGGTG GCTTCTACTGGATCTACACCTGG
KfN #1 Crfg TCTACATGCGCAAGGTGAAG TGCACAAGTCCGCATAGAAC
KfN #2 naa15 AAGCGGCTCGTGATGTATTG AAGGCCTGCAGACAATGAAG
KfN #3 emg1 CATCTGCGTCAAGAACAACC GCGCAGTATGGATGTAGATCAG
KfEn #1 emg1 TGACGTGCATTCGAGTATCC CACTTTGAGCAAGGTTGTCG
KfEn #2 psmd1 TTGGACTTGCCTTTGTCCTC TTCCAGCCATAGCAATACCC
KfEn #3 eif5b TCAGTTCACTCGCTTCATGG CTGGTTGAAAACGTGCTGTG
KfEn #4 naa15 GATTCGGAACCTGGACATTG GTAGCCTTCAGCGCAAAATC
KfEn #5 Crfg AGGACGCAACGTAAAACACC TCGTTCAAGCGAGGAAAGTC
KfEn #6 pno1 GTGGCATGGATGTTCAGATG CCGAAATCTCAGGAAAGACG
PtN + rbcL ACTGCAATCCAATCAGCTGC GATCCACACCACACATACGC
PtN #1 eif5b GGCCTTGGGATGACTGTTGA GACTAGGCGGTGGTGTCAAA
PtN #2 emg1 GGACACATCACGCTCGAAGA TACCCCAGTGATGCTCAACG
PtN #3 dimtl1 TGGGACGGAATGATTCGATTGT TCGGGATGAAGTGACTGAACTG
PtN #4 psmd1 AGTAGGTACCGGGGCAGAAT GTCGGCGTTTTCCTCTTGAC
PtN #5 pno1 TGAAATTACAGGTTCGCTTCAAT ACACAAAGTCGGCACCCTTT
PtN #6 naa15 GCCGATGCCGTACTTAAGAAG ACACGTGTGATCGCATATCA

The fragments amplified were examined through agarose gel electrophoresis (20 – 45mins, 110mV) (Lee et al. 2012). More specifically, 2μL of DNA Gel Loading Dye (6x, Thermo Scientific) was added in each 10μL PCR sample and loaded in 1% agarose gels containing EtBr for DNA staining. The appropriate sized bands were collected, after exposing the gel to UV light, and purified with the GeneJET Gel Extraction Kit (Thermo Scientific). The protocol followed for the purification of the bands was the one provided by the Thermo Scientific kit but all wash steps were repeated twice for maximisation of the DNA yield. Each sample was examined with a microvolume spectrophotometer (NanoDrop 2000c, Thermo Scientific) to find its DNA concentration.

Cloning

The gene fragments amplified were then cloned using the CloneJET PCR Cloning Kit (Thermo Scientific). The protocol followed was the blunt-end cloning one because the polymerase used (Phusion Flash II) created blunt-end PCR products. Transformation was carried out with the use of competent Escherichia coli cells, where 10μL of transformation mixture was added to 100μL competent E. coli cells. The mixture was then left on ice for 30min, incubated at 42oC for 45sec and placed on ice for 5min. The addition of 300μL Lysogeny Broth (LB) liquid medium to the transformation mix was followed with a 1h 37oC incubation while shaking at 200-250rpm. Lastly, 100μL and 200μL from each sample were spread onto LB agar plates that contained 100μg/mL ampicillin (stock of 100mg/mL) (LB+Amp plates) and the plates were incubated O/N at 37oC.

Restriction analysis

Following successful transformation, 1-2 colonies were hand-picked from the LB+Amp plates by using a pipette tip and placed in 3mL of LB+Amp liquid medium and incubated at 37oC for 12-16h, while shaking at 200-250rpm for bacterial culture growth. The mixture was then centrifuged at 6800g to achieve cell pelleting. The E. coli cell pellets were then treated with the GeneJET Plasmid Miniprep Kit (Thermo Scientific) for the extraction of the pJET1.2/blunt vectors used during cloning. Plasmid DNA concentration was measured with a microvolume spectrophotometer (NanoDrop 2000c, Thermo Scientific).

The plasmids were then treated with the restriction enzyme BglII (Thermo Scientific) under the following conditions: 1μL of plasmid DNA (0.5-1μg/μL), 2μL 10x Buffer O (Thermo Scientific), 1μL BglII (Thermo Scientific), and 16μL DNase.RNase-free water. The mixtures were mixed gently, spun down for a few seconds and then incubated for 2h at 37oC. Lastly, the samples were examined through 1% agarose (and EtBr) gel electrophoresis (20 – 45mins, 110mV) (Lee et al. 2012) after the addition of 4μL of DNA Gel Loading Dye (6x, Thermo Scientific).

Each plasmid sample was also amplified through PCR using a G-Storm GS1 Thermal Cycler under the following conditions: 0.5μL of plasmid DNA (10-15ng/μL), 0.5μL of each primer (0.5μΜ) (pJET1.2 Forward and Reverse Sequencing Primers, Thermo Scientific), 5μL of Phusion Flash High-Fidelity PCR Master Mix (Thermo Scientific), and DNase/RNase-free water up to 10μL. The cycling conditions were as follows: 10s of initial denaturation at 98oC followed by 35 cycles of 2s at 98oC (denaturation step), 5s at 55oC (annealing step) and 5s at 72oC (elongation step) and terminating with 1min of final elongation at 72oC and holding at 4oC.

The fragments amplified were examined through agarose gel electrophoresis (20 – 45mins, 110mV) (Lee et al. 2012). More specifically, 2μL of DNA Gel Loading Dye (6x, Thermo Scientific) was added in each 10μL PCR sample and loaded in 1% agarose gels containing EtBr for DNA staining.

Results

DNA was extracted by using two different techniques for diatom P. tricornutum and six different techniques for dinoflagellate K. foliaceum (Table 2). Both methods used for the diatom were successful with cell breakage reaching 100%, but cryogenic grinding was faster, only taking about 15min to achieve, in comparison with the long Proteinase K digestion, which took 2h. In extracting DNA from the dinoflagellate, cryogenic grinding was both the most successful out of the six methods (100% cell breakage) and the fastest. The efficiency, however, of long Proteinase K digestion closely followed the cryogenic grinding method.

Table 2. Methods used for DNA extraction. Kf, Kryptoperidinium foliaceum; Pt, Phaeodactylum tricornutum

Extraction Method Total Time Kf breakage Pt breakage
Long digestion 2h 15% 100%
CTAB 30min 0% –
3x Freeze/Thaw 10min 5% –
10x Freeze/Thaw 34min 7% –
Sand/Tris-EDTA 5min 3% –
Cryogenic grinding 10-20min 100% 100%

 

Microvolume spectrophotometer results of the two most efficient methods for DNA extraction from both organisms are presented in Table 3. The results for dinoflagellate DNA are practically the same for both methods even though six times more sample was used for the cryogenic grinding (2mL during the long digest and 12mL during cryogenic grinding). The results for diatom DNA, when comparing the two methods, show that concentration was higher with the cryogenic grinding method (298.4ng/μL compared to 145.6ng/μL) but DNA purification was lower (lower values for both 260/280 and 260/230).

Table 3. Microvolume spectrophotometer (NanoDrop 2000c, Thermo Scientific) results from the two best DNA extraction methods

Organism Extraction Method Sample (mL) CDNA (ng/μL) 260/280 260/230
K. foliaceum Long digestion 2 68.60 1.72 0.90
K. foliaceum Cryogenic grinding 12 69.40 1.60 0.85
P. tricornutum Long digestion 2 145.6 1.72 0.91
P. tricornutum Cryogenic grinding 8 298.4 1.55 0.67

After DNA extraction with the two different methods and purification of the samples collected from both organisms, the individual samples were analysed by agarose gel electrophoresis (Figure 1). Samples treated with the long Proteinase K digestion appeared at the top of the gel with no smearing patterns, meaning they showed the typical motif of intact DNA. Samples treated with cryogenic grinding, on the other hand, had faint bands at the top of the gel but showed smearing spanning the whole gel, all the way to a size of about 100bp, suggesting possible degradation of the DNA extracted.

C:UsersstephAppDataLocalMicrosoftWindowsINetCacheContent.WordMethods DNA.JPG

Figure 1. Agarose gel depicting DNA bands after their extraction with two different methods. Kf, Kryptoperidinium foliaceum; Pt, Phaeodactylum tricornutum; LD, Long Digestion; CG, Cryogenic grinding

A total of 31 primer sets were designed for K. foliaceum, 14 sets for the endosymbiont,and 28 primer sets for P. tricornutum (Supplementary Tables S1-S3).

Following the design of specific primers, P. tricornutum DNA was used for gene amplification (Figure 2). All seven genes were amplified by using touchdown PCR. All PCR bands appeared to be of the right size after comparison with the DNA ladder. PtNcrfg band is the only exception, appearing to be above 200bp (nearly 100bp above expected), and was not selected for gel extraction. The other 6 bands were extracted from the gel and cloned.

C:UsersstephAppDataLocalMicrosoftWindowsINetCacheContent.WordPh.jpg

Figure 2. Agarose gel with PCR products of the 6 genes amplified from P. tricornutum. Pt, Phaeodactylum tricornutum; N, nucleus; L, GeneRuler 100bp Plus DNA Ladder (Thermo Scientific)

Following the design of specific primers, K. foliaceum DNA was used for endosymbiont gene amplification (Figure 3). All seven of the genes originally selected were amplified after touchdown PCR. The gel created after the PCR showed bands with the correct size, after comparison with the DNA ladder. The extra gene appearing as a band in the gel, dimtl1 (KfEndimtl1), was also selected to be extracted from the gel and cloned, alongside the others, but its cloning was not successful.

C:UsersstephAppDataLocalMicrosoftWindowsINetCacheContent.WordDIA.JPG

Figure 3. Agarose gel with PCR products of the 6 genes amplified from the Kryptoperidium foliaceum endosymbiont. Kf, Kryptoperidinium foliaceum; En, Endosymbiont; L, GeneRuler 100bp Plus DNA Ladder (Thermo Scientific)

Following the design of specific primers, K. foliaceum DNA was used for amplification (Figure 4) and from the seven single-copy genes originally selected only three were successfully amplified. A total of 31 primer sets were designed and only three of those sets created bands that resembled the expected ones, the rest created non-specific bands or smears on the gels (Supplementary Figure S1). The three bands were removed from the gels, the DNA was extracted and then cloned.

C:UsersstephAppDataLocalMicrosoftWindowsINetCacheContent.WordKf emg1.jpg

Figure 4. Agarose gels with PCR products of the 3 genes amplified from Kryptoperidium foliaceum. Kf, Kryptoperidinium foliaceum; N, nucleus; L, GeneRuler 100bp Plus DNA Ladder (Thermo Scientific)

The PCR bands shown in the figures above were extracted from the agarose gels and DNA was purified. The microvolume spectrophotometer results from all samples collected are presented in Table 4. DNA concentration in each sample varies from 2.3ng/μL to 23.3ng/μL with the P. tricornutum samples having the most DNA per sample. The genes amplified from the dinoflagellate’s nuclear DNA have very low concentrations (2.3 ng/μL, 3.0ng/μL, and 8.5ng/μL respectively) as well as the lowest 260/230 values (-1.51 to 3.39).  

Table 4. Microvolume spectrophotometer (NanoDrop 2000c, Thermo Scientific) results from the genes amplified after touchdown PCR. Kf, Kryptoperidinium foliaceum; Pt, Phaeodactylum tricornutum; N, nucleus; En, Endosymbiont

Genome Gene CDNA (ng/μL) 260/280 260/230
KfN #1 crfg 2.30 2.55 -0.34
KfN #2 naa15 3.00 1.96 -1.51
KfN #3 emg1 8.50 1.86 3.39
KfEn #1 emg1 6.50 1.97 2.45
KfEn #2 psmd1 8.40 2.13 1.88
KfEn #3 eif5b 10.20 2.10 2.21
KfEn #4 naa15 6.40 2.46 1.88
KfEn #5 crfg 10.80 2.12 2.22
KfEn #6 pno1 7.60 2.07 1.28
PtN #1 eif5b 11.00 1.87 0.73
PtN #2 emg1 21.00 1.99 0.62
PtN #3 dimtl1 17.40 1.69 0.34
PtN #4 psmd1 23.30 1.93 10.30
PtN #5 pno1 7.30 1.98 1.31
PtN #6 naa15 3.70 1.75 -4.76

 

The 15 samples extracted and purified from the agarose gels were then cloned. The E. coli cells were treated accordingly so that the pJET1.2/blunt vectors were released and the microvolume spectrophotometer results of the released vectors appear in Table 5. DNA concentration of the vector is high with most having a concentration of above 100ng/μL. The same can be said for the 260/280 and 260/230 values meaning the samples extracted from the E. coli cells are all equally as pure. During the cloning procedure the endosymbiont gene dimtl1 (KfEndimtl1), appearing in Figure 3, was removed from further experimentation because no E. coli colonies appeared in the LB+Amp agar plates, meaning its cloning was not successful.

Table 5. Microvolume spectrophotometer (NanoDrop 2000c, Thermo Scientific) results from the pJET1.2/blunt vector that was extracted after successful cloning of the genes and size (bp) of the gene fragments amplified. Kf, Kryptoperidinium foliaceum; Pt, Phaeodactylum tricornutum; N, nucleus; En, Endosymbiont

Genome Gene CDNA (ng/μL) 260/280 260/230 Insertion size (bp)
KfN #1 crfg 249.20 1.92 2.22 114
KfN #2 naa15 131.00 1.94 2.16 101
KfN #3 emg1 213.70 1.91 2.11 128
KfEn #1 emg1 42.50 2.05 1.63 121
KfEn #2 psmd1 108.40 1.82 2.07 129
KfEn #3 eif5b 47.30 1.98 1.93 112
KfEn #4 naa15 59.00 1.98 1.84 148
KfEn #5 crfg 240.30 1.92 2.06 149
KfEn #6 pno1 102.90 1.92 1.99 144
PtN #1 eif5b 99.70 1.91 2.06 130
PtN #2 emg1 171.20 1.91 2.23 121
PtN #3 dimtl1 102.80 1.90 2.10 125
PtN #4 psmd1 133.40 1.88 2.06 139
PtN #5 pno1 187.30 1.92 2.11 105
PtN #6 naa15 300.30 1.91 2.19 142

The pJET1.2/blunt vectors released from the E. coli cells were amplified with PCR and examined on agarose gels (Figure 5). From the seven single-copy genes per genome selected originally, six genes were PCR-amplified and cloned from P. tricornutum and the Kryptoperidium endosymbiont and three genes from Kryptoperidinium foliaceum. The vector specific primers amplify a total of 121bp fragment alongside the insertion, explaining the higher than expected bands appearing on the gel. Most of the bands appear to be the right size after comparison with the DNA ladder. The 8th band with the KfN#2 insertion is a lot higher than expected with a size between 1500-2000bp. Lastly, non-specific bands appear in wells 1(KfEn#1), 2 (KfEn#2), and 9 (PtN#3).

C:UsersstephAppDataLocalMicrosoftWindowsINetCacheContent.WordVector PCR.JPG

Figure 5. Agarose gel with 15 PCR products amplified from pJET1.2/blunt vectors with vector specific primers. Kf, Kryptoperidinium foliaceum; Pt, Phaeodactylum tricornutum; N, nucleus; En, Endosymbiont; L, GeneRuler 100bp Plus DNA Ladder (Thermo Scientific)

 

Discussion

The cellulosic plating surrounding K. foliaceum, also known as the theca, proved hard to break during DNA extraction (Lau et al. 2007). This prevented the release of both the nuclear and the endosymbiont DNA, preventing the experiment from continuing. This became apparent after microscopy slides were created of the samples treated after a digestion period with Proteinase K lasting 15min, which is the typical digestion period. Cell breakage was 0%. Complete cell breakage was not required for the amplification of the genes but DNA needed to be present. On the other hand, complete cell breakage will be required for measuring the total DNA concentration per cell and the continuation of the experiment (Hirakawa et al. 2014). Different methods were tested for the theca breakage and most of those are normally used on plants. For example, the CTAB method is one ordinarily used for the extraction of DNA from plants containing high polysaccharide and polyphenol components (Porebski et al. 1997; Devi et al. 2013). The cryogenic grinding method is another such example normally used for its rapidity and convenience (Dellaporta et al. 1983). On the other hand, the sand/Tris-EDTA method has been known to be successful in the disruption of cells walls from gram-positive bacteria and mycobacteria (Sahin 2016). The long digestion method has been suggested for DNA extraction from phytoplankton by Yuan et al. (2015) but they suggested a digestion of 3 days instead of the 2h digestion carried out during this study.

The theca that surrounds K. foliaceum seems to break with most methods (Table 2) but its disruption in all cells present in the samples was only achieved after cryogenic grinding. Another method that proved successful was the long Proteinase K digestion, where enough cells were disrupted to be able to amplify the selected genes. This seems to apply for the diatom P. tricornutum as well, although both methods proved to be 100% successful. Out of the two methods mentioned above though, the long digestion appears to keep the DNA strands intact for both organisms whereas cryogenic grinding degrades the DNA (Figure 1). In this study the degradation of the DNA was not a problem since the gene fragments selected for amplification were 100-150bp in size. If the gene fragments were longer, then the DNA degradation could create issues during gene amplification. This became apparent after trying to amplify the original positive control used. The original positive control was also for the rbcL gene but the fragment the primers amplified was about 1500bp in size. After completion of the PCR, the resulting bands attributed to the positive control were either missing or appeared faint in the gels containing the DNA acquired after cryogenic grinding.

The genes selected for amplification are single-copy genes present in all eukaryotic genomes. In other words, the seven genes selected appeared in the genome of P. tricornutum, K. foliaceum, and its endosymbiont and did not appear in multiple copies in each genome.

The different primers used were designed for each organism individually (Supplementary Tables S1-S3). Primer design for P. tricornutum and the diatom endosymbiont of K. foliaceum was achieved using the cDNA of both organisms (Bowler et al. 2008;Imanian et al. 2010). On the other hand, K. foliaceum primers were designed using its genomic DNA since no cDNA library has been created, meaning the sequences that the primers were designed from contained introns. This led to the design of 31 different primer sets with only 3 primer sets amplifying genes of the expected size (Figure 4). The rest of the primers designed either did not create bands on the agarose gels or created non-specific bands and/or smears (Supplementary Figure S1). In the instance that non-specific bands and/or smears showed up on the gels, the fragment amplification reactions were repeated but with different touchdown PCR conditions. More specifically, the total number of cycles was reduced to 30, instead of 35 cycles, and the extension/elongation time was shortened to 2s, compared to the 5s it was before (Śpibida et al. 2017). These changes proved successful for the reduction of the non-specific bands and the smearing but the remaining bands were still not the ones expected for the primers that were used.

At the beginning of the experiment the polymerase used during the touchdown PCR was Taq DNA Polymerase, native (Thermo Scientific) but it was later replaced with Phusion High-Fidelity DNA Polymerase (Thermo Scientific). This was a conscious choice considering the Phusion polymerase has a higher fidelity (52x more accuracy than Taq), causes fewer reaction failures, requires minimal optimization as well as improves yield and is faster than the Taq polymerase (Śpibida et al. 2017). Lastly, Phusion polymerases create blunt-ended PCR products meaning less time is required during cloning. The Pfu DNA polymerase was also tested but in the end, it was replaced by the Phusion polymerase for the same reason Taq was.

During the study, touchdown PCR was used for gene amplification. This was done consciously after experimenting with different PCR cycling conditions, mostly because the primers designed appeared to be annealing incorrectly (Korbie & Mattick 2008). Generally, touchdown PCR is a good alternative since it offers a simple and rapid means to optimise PCRs, thus increasing specificity, sensitivity and yield without having to redesign primers. In this case it was employed mainly for the progressive transition from a high to a lower primer annealing temperature which increases correct primer annealing (Korbie & Mattick 2008).

Microvolume spectrophotometry (NanoDrop 2000c, Thermo Scientific) results after DNA extraction, gene amplification, and cloning (Tables 3 – 5) seem to not be as high as one would expect and do not follow the typical nucleic acid profile (Desjardins & Conklin 2010). Pure nucleic acids typically yield a 260/280 ratio value of ~1.8 for DNA and ~2.0 for RNA. Significantly different purity ratios may indicate the presence of proteins, phenol or other contaminants that absorb strongly at or near 280nm. The 260/230 purity ratio is also used when measuring DNA and its values are commonly in the range of 1.8-2.2. If these purity values are lower, the isolation technique used may require optimisation (Desjardins & Conklin 2010). Generally, sources of contaminants associated with specific nucleic acid isolation methods include Phenol/Trizol and column extraction (Desjardins & Conklin 2010). The DNA extraction from the agarose gels (Table 4) and the extraction of the vectors from the E. coli cells (Table 5) were achieved using column-based kits. This column-based extraction could lead to the contamination of the samples with residual guanidine contributing to higher absorbance at 230nm leading to lower 260/230 ratios (Desjardins & Conklin 2010).

Treatment of the pJET1.2/blunt vectors with the restriction enzyme BglII (Thermo Scientific) was unsuccessful and resulted in agarose gels depicting bands that only represent the vector with the insertion (Supplementary Figure S2). After the unsuccessful first restriction attempt, the treatment was repeated with an incubation at 37oC lasting 2h (instead of 6h) and double the amount of template DNA (2μL of DNA instead of 1μL). The restriction was not easy interpretable because the bands were faint. This seemingly incomplete digestion of the plasmids might not be a result of the restriction enzyme, however, but rather a result of the agarose gels. The agarose gels contain EtBr which is used to stain the DNA. When the gels are exposed to UV light, electrons in the aromatic ring of the ethidium molecule are activated leading to the release of energy in the form of light as the electrons return to ground state (Lee et al. 2012). Furthermore, EtBr works by inserting itself in the DNA molecule in a concentration depending manner allowing for the estimation of the amount of DNA in the bands based on their intensity (Lee et al. 2012). This could mean that the restriction of the plasmids worked but because the insertions are small, in comparison to the plasmid DNA (100-150bp and 2974bp respectively), more EtBr bound to the plasmid DNA leading to weaker insertion DNA bands that could not be viewed or in some cases could be viewed but were faint (Supplementary Figure S2).

The amplification of the plasmid DNA with the vector specific primers resulted in an agarose gel showing the expected bands after taking into consideration that backbone-specific primers were used (Figure 5). The non-specific bands appearing in wells 1 (KfEn#1), 2 (KfEn#2), and 9 (PtN#3) could be a result of either semi-successful cloning, where a non-specific insertion was cloned, or non-specific primer annealing during amplification. The amplification was repeated for new plasmids extracted from the E. coli cells and the secondary bands were eliminated for well 1 but not for wells 2 and 9. The amplification was also repeated for well 8 (KfN#2) which led to a stronger signal for the band that was expected for this gene fragment. The higher than expected band could be due to a bigger, non-specific insertion during the cloning process. This could be a result of unsuccessful cloning, where part of the vector was inserted in the plasmid, or a contamination of the DNA sample with a bigger fragment of DNA.

During this study the genome of the free-living diatom Phaeodactylum tricornutum was used as a comparison with the Kryptoperidinium endosymbiont. P. tricornutum is a model pennate diatom whose genome has been thoroughly analysed but it is not the closest free-living relative to the K. foliaceum endosymbiont. This, alongside the fact that diatom specific genes are fast evolving would mean comparison of the two genomes, in any way, would not yield successful results (Bowler et al. 2008; Hehenberger et al. 2016). This proved to not be a problem, however, because Hehenberger et al. (2016) showed that all general metabolic pathways and genetic information processing activities, such as transcription, translation and replication, in the free-living diatom were also present in the endosymbiont.

Interestingly, Tanaka et al. (2015), after investigating the free-living diatom, described a nuclear division resembling the one described in the endosymbiotic diatom. One of the things they noticed was a lack of a mitotic apparatus and of microtubules during the cell cycle suggesting that the endosymbiont undergoes normal cell division unaffected by the endosymbiosis (Tanaka et al. 2015; Hehenberger et al. 2016). This as well as the high similarity of the endosymbiont transcriptome to its free-living relatives, suggest that mitosis is still under the control of the endosymbiont, but it still doesn’t answer how the host and the endosymbiont have achieved a synchronized cell cycle (Hehenberger et al. 2016). Huysman et al. (2010), after the discovery of diatom-specific cyclins responding to nutritional signals, have suggested, however, that this synchronisation could be the result of environmental cues.     

 

Future directives

New K. foliaceum primers need to be designed for the amplification of at least two more gene fragments for the comparison between the genomes to be statistically accurate.

Furthermore, except for repeating the cloning process for the KfN#2 gene (Figure 5), the reduction of the primer concentrations during plasmid PCR and the reduction of the total number of PCR cycles will help eliminate non-specific primer annealing and extension (Śpibida et al. 2017). Further proof of the success rate of the cloning process would be sequencing data showing the length and sequence of the insertions. This would prove that the gene fragments amplified and then cloned were indeed the ones selected for the comparison between the genomes.

Establishing ploidy via qPCR will require the measurement of the total amount of DNA per cell. This will be made possible after microscopically counting all the cells of a sample or measuring cultured cell density (cells/mL) using a haemocytometer. This will be followed by total DNA extraction through the cryogenic grinding method and its measurement with microvolume spectrophotometry (Hirakawa et al. 2014).

After the successful amplification and cloning of the K. foliaceum genes, all the plasmid samples will be serial diluted for the creation of standard curves. Then real-time quantitative PCR (qPCR) will follow for the calculation of the Ct values for each sample. The Ct values, alongside the dilution curves, will help with the calculation of the copy number of the target DNA genes (Hirakawa et al. 2014). It is recommended that the qPCR analysis be repeated at least three times to estimate standard deviations.

Conclusion

This project was focused on gene cloning and DNA extraction steps in a broader effort of understanding the ploidy in the dinoflagellate Kryptoperidinium foliaceum. It helped with overcoming the obstacles set by the dinoflagellate theca when extracting DNA and this organism’s lack of sequenced cDNA that led to non-specific primer design due to introns intermitting the genomic sequence. Furthermore, it helped find the right conditions required for gene amplification but further primers need to be designed for the amplification, and subsequent cloning, of more Kryptoperidinium genes. Then, qPCR will help calculate the copy number of the target DNA genes. Resolving the ploidy of the Kryptoperidinium endosymbiont will allow us to understand how its nucleus divides and whether polyploidization is a general characteristic of highly reduced endosymbiont genomes (Hirakawa et al.2014). To further test this hypothesis, genomic copy number should be investigated in a broad range of evolutionary distinct endosymbionts.

 

References

Bhattacharya D, Archibald JM, Weber APM, Reyes-Prieto A. How do endosymbionts become organelles? Understanding early events in plastid evolution. BioEssays 2007; 29:1239-1246.

Bhaud Y, Guillebault D, Lennon J, Defacque H, Soyer-Gobillard MO, Moreau H. Morphology and behaviour of dinoflagellate chromosomes during the cell cycle and mitosis. J Cell Sci 2000; 113: 1231 LP-1239.

Bojko M, Brzostowska K, Kuczy??ska P, Latowski D, Olchawa-Pajor M, Krzeszowiec W, et al. Temperature effect on growth, and selected parameters of Phaeodactylum tricornutum in batch cultures. Acta Biochim Pol 2013; 60: 861–864.

Bowler C, Allen AE, Badger JH, Grimwood J, Jabbari K, Kuo A, et al. The Phaeodactylum genome reveals the evolutionary history of diatom genomes. Nature 2008; 456: 239–244.

Bravo I, Figueroa R. Towards an Ecological Understanding of Dinoflagellate Cyst Functions. Microorganisms 2014; 2: 11–32.

Chesnick JM, Kooistra W, Wellbrock U, Medlin LK. Ribosomal RNA analysis indicates a benthic pennate diatom ancestry for the endosymbionts of the dinoflagellates Peridinium foliaceum and Peridinium balticum (Pyrrhophyta). J Eukaryot Microbiol 1997; 44:314–20.

Dellaporta SL, Wood J, Hicks JB. A plant DNA minipreparation: Version II. Plant Mol Biol Report 1983; 1: 19–21.

Desjardins P, Conklin D. NanoDrop Microvolume Quantitation of Nucleic Acids 2. High-Sensitivity Microvolume Nucleic Acid Quantitation Using the NanoDrop 3300. Jove 2010; 1–4.

Desjardins PR, Conklin DS. Microvolume quantitation of nucleic acids. Curr Protoc Mol Biol 2011; 1–16.

Devi KD, Punyarani K, Samarjit Singh N, Sunitibala Devi H. An efficient protocol for DNA extraction from the members of order Zingiberales-Suitable for diverse PCR based downstream applications. Springer Open J 2013; 2: 2–10.

Dodge JD. A dinoflagellate with both a mesocaryotic and a eucaryotic nucleus I. Fine structure of the nuclei. Protoplasma 1971; 73:145–57.

Figueroa RI, Bravo I, Fraga S, Garcés E, Llaveria G. The Life History and Cell Cycle of Kryptoperidinium foliaceum, A Dinoflagellate with Two Eukaryotic Nuclei. Protist 2009; 160: 285–300.

Gabriel ML. Primitive genetic mechanisms and the origin of chromosomes. Am Nat 1960; 94: 257-269.

Gavrila L. Cytogenetical investigations in mesokaryotic algae i. The nuclear division, chromosomes and the tentative karyotype. Caryologia 1977; 30: 273–287.

Gómez F. a Checklist and Classification of Living. CICIMAR Oceánides 2012; 27: 65–140.

Gordon N, Angel DL, Neori A, Kress N, Kimor B. Heterotrophic dinoflagellates with symbiotic cyanobacteria and nitrogen limitation in the Gulf of Aqaba. Mar Ecol Prog Ser 1994; 107: 83–88.

Guillard RR, Ryther JH. Studies on marine planktonic diatoms. I. Cyclotella nana Hustedt and Detonula confervacaea (Cleve) Gran. Can J Microbiol 1962; 8: 229–239.

Guiry MD. How many species of algae are there? J Phycol 2012; 48: 1057–1063.

Hamkalo BA, Rattner JB. The structure of a mesokaryote chromosome. Chromosoma 1977; 60: 39–47.

Hansen FC, Witte HJ, Passarge J. Grazing in the heterotrophic dinoflagellate Oxyrrhis marina: Size selectivity and preference for calcified Emiliania huxleyi cells. Aquat Microb Ecol 1996; 10: 307–313.

Hehenberger E, Burki F, Kolisko M, Keeling PJ. Functional Relationship between a Dinoflagellate Host and Its Diatom Endosymbiont. Mol Biol Evol 2016; 33: 2376–2390.

Hirakawa Y, Ishida K-I. Polyploidy of Endosymbiotically Derived Genomes in Complex Algae. Genome Biol Evol 2014; 6: 974–980.

Huysman MJJ, Martens C, Vandepoele K, Gillard J, Rayko E, Heijde M, et al. Genome-wide analysis of the diatom cell cycle unveils a novel type of cyclins involved in environmental signaling. Genome Biol 2010; 11: R17.

Imanian B, Pombert JF, Keeling PJ. The complete plastid genomes of the two ‘Dinotoms’ Durinskia baltica and Kryptoperidinium foliaceum. PLoS One 2010; 5.

Inagaki Y, Dacks JB, Ford Doolittle W, Watanabe KI, Ohama T. Evolutionary relationship between dinoflagellates bearing obligate diatom endosymbionts: Insight into tertiary endosymbiosis. Int J Syst Evol Microbiol 2000; 50:2075–2081.

Janouškovec J, Gavelis GS, Burki F, Dinh D, Bachvaroff TR, Gornik SG, et al. Major transitions in dinoflagellate evolution unveiled by phylotranscriptomics. Proc Natl Acad Sci 2017; 114: E171–E180.

Keeling PJ. The endosymbiotic origin, diversification and fate of plastids. Philos Trans R Soc Lond B Biol Sci 2010; 365:729–748.

Kite GC, Rothschild LJ, Dodge JD. Nuclear and plastid DNAs from the binucleate dinoflagellates Glenodinium (Peridinium) foliaceum and Peridinium balticum. BioSystems 1988; 21: 151–163.

Komaki K, Ishikawa H. Intracellular bacterial symbionts of aphids possess many genomic copies per bacterium. J Mol Evol 1999; 48:717–722.

Korbie DJ, Mattick JS. Touchdown PCR for increased specificity and sensitivity in PCR amplification. Nat Protoc 2008; 3: 1452–1456.

Lau RK, Kwok AC, Chan WK, Zhang TY, Wong JT. Mechanical characterization of cellulosic thecal plates in dinoflagellates by nanoindentation. J Nanosci Nanotechnol 2007; 7: 452–457.

Leadbeater B, Dodge JD. Fine Structure of the Dinoflagellate Transverse Flagellum. Nature 1967; 213: 421.

Lee PY, Costumbrado J, Hsu C-Y, Kim YH. Agarose Gel Electrophoresis for the Separation of DNA Fragments. J Vis Exp 2012; 1–5.

Morden CW, Sherwood AR. Continued evolutionary surprises among dinoflagellates. Proc Natl Acad Sci 2002; 99: 11558–11560.

Okamoto N, Keeling PJ. A Comparative Overview of the Flagellar Apparatus of Dinoflagellate, Perkinsids and Colpodellids. Microorganisms 2014; 2: 73–91.

Orr RJS, Murray SA, Stüken A, Rhodes L, Jakobsen KS. When Naked Became Armored: An Eight-Gene Phylogeny Reveals Monophyletic Origin of Theca in Dinoflagellates. PLoS One 2012; 7: 1–15.

Pienaar RN, Sakai H, Horiguchi T. Description of a new dinoflagellate with a diatom endosymbiont, Durinskia capensis sp. nov. (Peridiniales, Dinophyceae) from South Africa. J Plant Res 2007; 120: 247.

Porebski S, Bailey LG, Baum BR. Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Mol Biol Report 1997; 15: 8–15.

Raikov IB. Structure and Genetic Organization of the Polyploid Macronucleus of Ciliates: a Comparative Review. Acta Protozool 1995; 34: 151–171.

Ruggiero MA, Gordon DP, Orrell TM, Bailly N, Bourgoin T, Brusca RC, et al. A Higher Level Classification of All Living Organisms. PLoS One 2015; 10: e0119248.

Sahin F. Using Sand Particles for the Disruption of Cell Walls of Gram-Positive Bacteria and Mycobacteria. J Bacteriol Parasitol 2016; 07: 290.

Saldarriaga JF, Taylor FJR, Keeling PJ, Cavalier-Smith T. Dinoflagellate nuclear SSU rRNA phylogeny suggests multiple plastid losses and replacements. J Mol Evol 2001; 53: 204–13.

Spector DL, Triemer RE. Chromosome structure and mitosis in the dinoflagellates: An ultrastructural approach to an evolutionary problem. Biosystems 1981; 14: 289–298.

Śpibida M, Krawczyk B, Olszewski M, Kur J. Modified DNA polymerases for PCR troubleshooting. J Appl Genet 2017; 58: 133–142.

Stat M, Morris E, Gates RD. Functional diversity in coral-dinoflagellate symbiosis. Proc Natl Acad Sci 2008; 105: 9256–9261.

Stentiford GD, Shields JD. A review of the parasitic dinoflagellates Hematodinium species and Hematodinium-like infections in marine crustaceans. Dis Aquat Organ 2005; 66: 47–70.

Stoecker DK. Mixotrophy among Dinoflagellates1. J Eukaryot Microbiol 1999; 46: 397–401.

Takano Y, Hansen G, Fujita D, Horiguchi T. Serial Replacement of Diatom Endosymbionts in Two Freshwater Dinoflagellates, Peridiniopsis spp. (Peridiniales, Dinophyceae). Phycologia 2008; 47:41–53.

Tanaka A, De Martino A, Amato A, Montsant A, Mathieu B, Rostaing P, et al. Ultrastructure and membrane traffic during cell division in the marine pennate diatom Phaeodactylum tricornutum. Protist 2015; 166:506–521.

Taylor FJR, Hoppenrath M, Saldarriaga JF. Dinoflagellate diversity and distribution. Biodivers Conserv 2008; 17:407–418.

Tengs T, Dahlberg OJ, Shalchian-Tabrizi K, Klaveness D, Rudi K, Delwiche CF, et al. Phylogenetic Analyses Indicate that the 19′Hexanoyloxy-fucoxanthin-Containing Dinoflagellates Have Tertiary Plastids of Haptophyte Origin. Mol Biol Evol 2000; 17: 718–729.

Tippit DH, Pickett-Heaps JD. Apparent amitosis in the binucleate dinoflagellate Peridinium balticum. J Cell Sci 1976; 21: 273–289.

Valiadi M, Iglesias-Rodriguez D. Understanding Bioluminescence in Dinoflagellates—How Far Have We Come? Microorganisms 2013; 1: 3–25.

Wilcox LW, Wedemayer GJ. Dinoflagellate with blue-green chloroplasts derived from an endosymbiotic eukaryote. Science 1985; 227; 192-194.

Wyatt T, Zingone A. Population dynamics of red tide dinoflagellates. Deep Sea Res Part II Top Stud Oceanogr 2014; 101: 231–236.

Yuan J, Li M, Lin S. An improved DNA extraction method for efficient and quantitative recovery of phytoplankton diversity in natural assemblages. PLoS One 2015; 10: 1–18.

Supplementary Material

Supplementary Table S1. All primer sets designed using the software Primer3web (http://www.bioinfor matics.nl/cgi-bin/primer3plus/primer3plus.cgi/primer3plus.cgi, last accessed April 19, 2018) for the 7 single-copy housekeeping genes and the rbcL gene from Kryptoperidinium foliaceum

Organism Target Genome Coding Gene Forward Primer Reverse Primer
K. foliaceum Nuclear rbcL AGTGACCGTTACGAATCTGGTG GCTTCTACTGGATCTACACCTGG
Nuclear crfg TCTATGCGGACTTGTGCAAC TGCACTTGTACAAGCTGTCC
TCGACGTTTCGGAAATGTGC GTCGGTCTTGTTCAAGATGACC
TTCCCGAAGATCGACGACATC TTCTTCGTCGCGTTGATCTG
TCTACATGCGCAAGGTGAAG TGCACAAGTCCGCATAGAAC
CGATCCATCCTTTGTTCAGG TATCCAACAACGCCTTCTCC
Nuclear naa15 ACTTGTCGTTGCTGCAGATC ATGCGAACTCGTAGTGCTTG
TACAAAAAGGGCGTCAAGGC TCTTCGCCAAGTAGCTCACG
AAGCGGCTCGTGATGTATTG AAGGCCTGCAGACAATGAAG
TTGAGGAGCCATGTCTGTTG GCAAGATCTGCATGTTCTCC
Nuclear emg1 AAAGTACTTCGCCCCAGGAAG ACAGCCCCAATGGAAAAGAC
ACAAGTTGTTGCCGCGAAC TTGTGGTCATCGCTGTTGAG
CATCTGCGTCAAGAACAACC GCGCAGTATGGATGTAGATCAG
TCAAGAACAACCGGGACATC CGCAGTATGGATGTAGATCAGC
Nuclear dimtl1 AACTTGCCCTACCAGATCTCC ATCAACCGCTCTGCAAACTC
TCCAGAAGGAGTTTGCAGAGC AGACGCAAGAGACCTTCACG
TGACGAAGGACACCATGAAG GCAAGACCTTTTCCCTCATC
ACTCCATGGTCGTCAAGGTC TTCATGGTGTCCTTCGTCAG
Nuclear pno1 TTCGAGATCCAGGACGTCAAG TTCTCGCACAAGGAAATCCG
TATGGTAAGCCGGAGTTCGC AACTTCAAGTGCTCCACGAC
TGGAGCACTTGAAGTTGCAG TGAAGGCCTTGAAGTAGTCG
TGTGCGAGAACAAGATCCAC GCAACTTCGTGTACACCTTCC
Nuclear psmd1 ATGGAGATCGCCAAGATCC TTCTCGTTGTCCACGATGTC
CAGTGCTACTTCATCCTCAACG TTGCAGAAGTGCTGGTTCTC
Nuclear eif5b TGGTCATCGGGTTGAAACAG TGTGCTGTATGTGTGTGTGC
TGTACCAGTGGAAGGACAAGC AGTACAACGCGCAATTCAGG
TGAATTGCGCGTTGTACTGG TCTTGAGCGCCATGTAGAGC
AGCGACATGAAGATCCCAGTC TTCTTCGCCTCGTTGTTGAC
GAAGGACAACATGGTCATCG TGTTCTGCTCGATCTTCACG
TCGACGTGAAGGTCAACAAC TGGTGAACTTGTCGAAGAGG

Supplementary Table S2. All primer sets designed using the software Primer3web (http://www.bioinfor matics.nl/cgi-bin/primer3plus/primer3plus.cgi/primer3plus.cgi, last accessed April 19, 2018) for the 7 single-copy housekeeping genes from the Kryptoperidinium foliaceum endosymbiont

Organism Target Genome Coding Gene Forward Primer Reverse Primer
K. foliaceum Endosymbiont emg1 GAATCACTTGGGCTTGGTTG TATGGTGCAGGAGATGCTTG
TGACGTGCATTCGAGTATCC CACTTTGAGCAAGGTTGTCG
Endosymbiont psmd1 TTGGACTTGCCTTTGTCCTC TTCCAGCCATAGCAATACCC
TTGCAAGAGCCAGATGTCAC AAGGGCAAATCCAAGTCCTC
Endosymbiont eif5b CAATGCGACAAGCTGGTATG TCAGACGGTTTCTGCTGTTG
TCAGTTCACTCGCTTCATGG CTGGTTGAAAACGTGCTGTG
Endosymbiont naa15 AGTTGGAAAGCACCGTATGC GCAGATTTGGAGAACGAAGG
GATTCGGAACCTGGACATTG GTAGCCTTCAGCGCAAAATC
Endosymbiont crfg AGGACGCAACGTAAAACACC TCGTTCAAGCGAGGAAAGTC
TCTCATGTGGGAGAATGGTG TCTCGGGGATAGCATCAAAG
Endosymbiont pno1 GTGGCATGGATGTTCAGATG CCGAAATCTCAGGAAAGACG
TTCAGCGTCCACTACCATTG CCGAAATCTCAGGAAAGACG
Endosymbiont dimtl1 GGTGGACCAATTGCTGAAAG ATCATTCCATCCCACTCGAC
GGACCAATTGCTGAAAGTCG CGAATCATTCCATCCCACTC

 

Supplementary Table S3. All primer sets designed using the software Primer3web (http://www.bioinfor matics.nl/cgi-bin/primer3plus/primer3plus.cgi/primer3plus.cgi, last accessed April 19, 2018) for the 7 single-copy housekeeping genes and rbcL gene from the diatom Phaeodactylum tricornutum

Organism Target Genome Coding Gene Forward Primer Reverse Primer
P. tricornutum Nuclear rbcL ACTGCAATCCAATCAGCTGC GATCCACACCACACATACGC
Nuclear eif5b ATGGCTCAGCGCAAGATAAC TCACCTTCGCGCAAAAATCC
AGGCGTTCCTTTTGTGGTTG ATTCGGACATTGTGCTGTCG
GGCCTTGGGATGACTGTTGA GACTAGGCGGTGGTGTCAAA
TGTTGGACCCGGTGATGAAG CTCCCAATGTTGAGGCCTGT
Nuclear emg1 ACGATTCGCTGGTCTTTTCG TTGCCTTGACAGCTCATTCC
ACCCGACATTTTGCACCAAG GCGAATCGTTTGTAGGTTCGAG
TTCCCAATACCTTCCCGCTG GTTTGTTTGCTGGCCTCGAG
GGACACATCACGCTCGAAGA TACCCCAGTGATGCTCAACG
Nuclear dimtl1 TGCAAGACTCTCCATTTGCG TGACCCCGCTTTTTCAATGC
GTGACGCTATGAAGACAGCTTG AACGGCACAACGAAACATGG
AACAAAATTTTCGCCCGCCA ACAATCGAATCATTCCGTCCCA
TGGGACGGAATGATTCGATTGT TCGGGATGAAGTGACTGAACTG
Nuclear psmd1 AATTGGGCGAGATAGTTGCG ATCAATGCGTCGGCGTTTTC
ATCAAGCCTTTGCACAAGCG AGAGAGTTCGGCCGAAAAAC
CGGCCGATCTTGCAGTAGTA TATCTCGCCCAATTCTGCCC
AGTAGGTACCGGGGCAGAAT GTCGGCGTTTTCCTCTTGAC
Nuclear pno1 AAAAGGGTGCCGACTTTGTG GTCCGTGACCTGGAAACTTTC
TTTTCCGGTCACACCAAGTC ACAAAGTCGGCACCCTTTTG
TGAAATTACAGGTTCGCTTCAAT ACACAAAGTCGGCACCCTTT
TCGGCACTACAAGCGACG GGTATTGAAGCGAACCTGTAATT
Nuclear naa15 ACATGTTGCAAGCAGGCATG CTTTTGCGCAAGACAAGCTG
ACGTGAGTGTTTTGCGCTTC ATAGTCAGGTTCAGCCGTATCG
AGCTTGAAGAAATACAGCGCTG GAAGCGCAAAACACTCACGT
GCCGATGCCGTACTTAAGAAG ACACGTGTGATCGCATATCA
Nuclear crfg ATTTGACCTGCAGTGTGCTC TGAGCTGCTTGTTCGCAAAC
TTGCCGATTTTGTGGATGCG AGATCTGATTCCGGCTCTTCAC
ATCCCCGACTCTGATGGTGT TGGTCGCGATAATCAGGAGC
GGGCAAGAAGATTGAAGGCG ACACCATCAGAGTCGGGGAT

C:UsersstephAppDataLocalMicrosoftWindowsINetCacheContent.WordKf - S1.jpg

Supplementary Figure S1. Agarose gels with PCR products from nine primer sets amplified from Kryptoperidium foliaceum. Non-specific bands and smears are present in the gel. Different primer sets and different PCR cycling conditions were used to optimise gene amplification. L, GeneRuler 100bp Plus DNA Ladder (Thermo Scientific); a, one set of primers; b, second set of primers

C:UsersstephAppDataLocalMicrosoftWindowsINetCacheContent.WordIMG_20180426_142340.jpg

Supplementary Figure S2. Agarose gels with 15 vectors after two attempts with a restriction enzyme treatment. The most prominent bands in both attempts represent the vectors with the different insertions. Upper two pictures – 1st Attempt: 6h incubation at 37oC and 1μL DNA, Lower two pictures – 2nd Attempt: 2h incubation at 37oC and 2μL DNA Kf, Kryptoperidinium foliaceum; Pt, Phaeodactylum tricornutum; N, nucleus; En, Endosymbiont; L, GeneRuler 100bp

study
http://au.freedissertation.com

You must be logged in to post a comment