Cognitive Basis for the Selectivity of Age-related Memory Impairment
AN INVESTIGATION OF THE COGNITIVE BASIS FOR THE SELECTIVITY OF AGE-RELATED MEMORY IMPAIRMENT
Older adults have been found to have a selective impairment in certain types of episodic memory, although other types of memory are generally preserved. The goal of this research is to determine whether the selective age-related memory deficit is best explained by an impairment in perceptual processing, an impairment in the formation of associations between items and their contexts, or an impairment in controlled processing, which is presumed to be required for recollection. Three behavioral experiments were conducted which attempted to evaluate the relative merits of each of these three accounts of age-related memory impairment. To allow for a more meaningful comparison of the data from each experiment, the same participants completed all three behavioral experiments. In addition to the behavioral experiments, an event-related potential (ERP) experiment was conducted to provide further information regarding perceptual processing differences between older and younger adults. When relying solely on perceptual information, rather than semantic and perceptual information, older adults’ memory performance was especially poor for perceptually impoverished stimuli (words), but less so for perceptually rich stimuli (pictures). Unlike young adults, older adults did not benefit from repeated presentations of pair information, suggesting that older adults do not form associative links between to-be-remembered stimuli. However, older adults did not show a recollection-specific impairment as the controlled processing hypothesis would have predicted. Older adults were equivalently impaired for both recollection and familiarity measures, suggesting that controlled processing is not specifically impaired in older adults. ERPs for older adults had much more individual variability than for young adults and the differences in ERP waveforms between age groups were observed more consistently in word conditions than in picture conditions, which is consistent with the behavioral results. Additionally, older adult ERPs to pictures were most similar to young adults, in accordance with the behavioral results. The behavioral data support the hypothesis that there is a deficit in perceptual processing which may help explain age-related memory impairments. The ERP data, though limited, lends some support to this explanation as it reveals perceptual and semantic processing differences between young and older adults. An associative deficit may be an additional source of memory impairment.
1.0 INTRODUCTION
Researchers frequently describe impairments in episodic memory that are associated with aging (e.g., Johnson, Hashtroudi & Lindsay, 1993), despite the preservation of other types of memory in older adults (e.g., Laver & Burke, 1993). Episodic memory can be roughly divided into two common types of subjective memory phenomena (Rugg & Yonelinas, 2003; Knowlton, 1998; Hintzman, et al., 1998; Hintzman & Curran, 1994; Yonelinas, 1994; Jacoby, 1991; Gardiner & Parkin, 1990; Humphreys, et al., 1989; Jacoby & Dallas, 1981, Mandler, 1980; Atkinson & Juola, 1974). Perhaps the more stereotypical of the two types is the recollective experience: one remembers having encountered an object, person, etc., and can specifically recall many of the particular details of that experience. These details might typically include the appearance of the object in question, the surrounding environment, the context of the experience in place and time, and perhaps even the thoughts or emotions being experienced during the encounter (Tulving, 1984). Another common memory experience is the experience of familiarity: one has a sense of knowing that something has been encountered before, but cannot recall the particular context in which the encounter took place. The familiarity-recollection division of episodic memory is a valuable framework for examining the age-related changes in episodic memory because the deficits repeatedly found in episodic memory among older adults can be conveniently described as a selective impairment of recollective memory (Light & Singh, 1987; Perfect, et al., 1995; Perfect & Dasgupta, 1997; Balota, etal., 2000; Clarys, etal., 2002). Recollection and familiarity, however, are often poorly defined terms in research of older adult memory and there is little explanation of the underlying cognitive processes. As a result, the cognitive basis of the selectivity in age-related memory impairment is not well understood.
The goal of this research is to determine whether the cognitive underpinnings of the selective age-related memory deficit are best accounted for by an impairment in perceptual processing, an impairment in the formation of associations between items and their contexts, or an impairment in controlled processing. In pursuit of this goal, three behavioral experiments were conducted which attempted to capture each of the three hypothetical impairments listed above. To allow for a more meaningful comparison of the data from each experiment, the same participants completed all three behavioral experiments. In addition to the behavioral experiments, an event-related potential (ERP) experiment was conducted to provide further information regarding perceptual processing differences between older and younger adults. Each experiment is informed by a particular theory of age-related memory impairment. These three theories are described below.
1.1 THEORIES OF AGE-RELATED MEMORY IMPAIRMENT
1.1.1 Perceptual proccesing impairment
One way of characterizing the selective age deficit in memory is as a specific impairment of perceptual processing, whereas conceptual processing is preserved. According to this view, recollection and familiarity differ primarily in the use of perceptual information. Specifically, recollection depends on the use of perceptual information for the specific details of an item and familiarity depends on the use of conceptual information, such as semantic or relational features (Brainerd, et al., 1999; Brainerd, et al., 1995). In this framework, separate perceptual and conceptual representations are formed at the encoding stage of memory. The process of perceptual retrieval is an all-or-none process that corresponds to recollection. The process of conceptual retrieval is a graded process that corresponds to familiarity. Thus, according to this type of memory theory, familiarity and recollection are characterized in terms of the type of information they use.
A perceptual/conceptual processing model can account for the selectivity of the age-related memory deficit by proposing that perceptual memory processing is specifically impaired in older adults (Koutstaal et al., 2001; Koutstaal, et al., 1999; Koutstaal & Schacter, 1997). Thus the tendency for older adults to rely on familiarity is the result of preserved conceptual-based processing. A perceptual-processing deficit impairs the ability to distinguish between items studied in different contexts.
1.1.2 Associative encoding impairment
Some theories of age-related memory impairment argue that older adults are impaired in memory for context but not for item (Naveh-Benjamin, 2000; Glisky, et al., 2001; Smith et al., 1998; Naveh-Benjamin & Craik, 1995; Park et al., 1990; McIntyre & Craik, 1987). Some research in young adults has supported the idea that recollection is characterized by memory for the context in which an item was first experienced (Perfect, et al., 1996; Johnson, 1997; Johnson, et al., 1993). However, results have been mixed regarding the ability of older adults to utilize context. In fact, the problem for older adults may not be with processing context per se but in binding an item to its context. Several studies highlight a context-item binding difficulty for older adults (Chalfonte & Johnson, 1996; Mitchell, et al., 2000; Naveh-Benjamin, 2000). Interestingly,
Naveh-Benjamin’s associative encoding hypothesis (AEH) for older adults is quite similar to a model of healthy episodic memory, the ICE model (item-context-ensemble; Murnane, et al., 1999), although both were developed independently. ICE makes the claim that accurate recollection depends not only on memory for item and context information individually, but, crucially, on the integration of these two types of information into unique memory representation called an ensemble (Murnane, et al., 1999). The ensemble enables the individual to have accurate memory for an item embedded within a specific context, rather than mere familiarity with both the item and context but not their relationship. The distinction between recollection and familiarity is defined at the encoding stage, based on whether an ensemble is formed that will enable future recollection. Formation of an ensemble requires the creation of associative features based on conjunctive information about item and context derived through elaborate processing.
The associative encoding model explains age-related deficits in memory as a specific impairment in the memory for components (items and context) of an episode and the relationship of the components to each other (Naveh-Benjamin, 2004). This explanation is the same as the ICE model explanation. It is the failure to properly associate the item and context at encoding, rather than a deficit in the processing of either item or context information individually, that is difficult for older adults. If associative links are not properly formed between items and their contexts at the encoding stage, the circumstantial details related to items cannot be effectively used in determining whether a cue matches an item in memory. For example, impaired ensemble formation would decrease the ability to discriminate between study lists. The process- dissociation procedure (Jacoby, 1991), explains inability to discriminate between study lists as a failure of recollection to oppose familiarity but impaired ensemble formation could explain it due to difficulty remembering in which experimental context an item was originally embedded. If normal memory processes involve the encoding of associative features between items and context, then it should be expected that associative features should be encoded when the context is actually another item in a pair.
1.1.3 Controlled processing impairment
Another common characterization of the selective age deficit in memory is as a specific impairment of controlled processing. According to such an account, the distinction between recollection and familiarity can primarily be defined by differences in attentional resources required to carry out the component processes. Specifically, recollection is supported by controlled processes and familiarity is supported by automatic processes (see Yonelinas, 2002, for review). The cognitive processes underlying both recollection and familiarity may operate on the same informational content from the environment, including perceptual and conceptual features of external stimuli and memory traces. Controlled processes are assumed to require attentional resources and occur at a relatively slow rate. Automatic processes are assumed to occur at a relatively fast rate, without the use of attentional resources.
The selectivity of the age-related deficit in memory can be accounted for, in this theoretical framework, as a specific impairment of controlled processing. If controlled processing is damaged, then the necessary cognitive operations underlying recollective memory will not effectively be carried out. Processes underlying familiarity are thought to be spared in old age because they can be executed without the need for controlled processing.
1.2 SUMMARY
Older adults experience a deficit in the type of memory referred to as recollection which requires remembering details of a past experience, such as perceptual features or the context in which the experience took place. The perceptual processing impairment theory posits that older adults have difficulty extracting and/or manipulating perceptual features when processing information. The associative encoding impairment posits that older adults cannot bind information about contexts and the items in the context. The controlled processing impairment posits that older adults have difficulty allocating attention to details of an experience. Since the goal of this study is to determine the best characterization of the age-related memory impairment, the three theories, perceptual processing impairment, associative encoding impairment, and controlled processing impairment, are necessarily framed as competitors. However, it is possible that the explanations are not mutually exclusive, as there may be more than one cognitive impairment in older adults that contributes to age-related memory impairment. Perceptual processing deficits could be the source of the associative encoding impairment and associative encoding could be a type of controlled process. Based on the data reported below I will argue that the age-related memory deficit is best accounted for by a perceptual processing impairment but that associative encoding may also play a role when context-item relationships are specifically tested. The data do not support the controlled processing impairment as an explanation of age-related memory deficits.
2.0 EXPERIMENT 1
2.1 RATIONALE
Two competing hypotheses for the selectivity of the age deficit are that it results from an impairment of representations for perceptual details, and that it results from an impairment of controlled processing. Experiment 1 tested both of these hypotheses simultaneously.
If the encoding of perceptual details is specifically impaired in older adults, then older adults should exhibit preferential processing of semantic information as opposed to perceptual information. Three previous studies have specifically tested the encoding of perceptual versus conceptual information in older adults. One study found that older adults had more false alarms for concrete pictures, than for abstract pictures (Koutstaal, et al., 2003). Concrete pictures were picture representations of objects in the world. Abstract pictures were line drawings that were not representative of any object or concept in the world. The concrete pictures carried more semantic (conceptual) information than the abstract pictures, which lacked semantic information since they did not correspond to any object or concept. The fact that older adults had more false alarms to concrete pictures than to abstract pictures can be interpreted as a tendency for older adults to disregard perceptual information by relying on semantic information when it is available, as in the case of concrete pictures. However, a different study using words and nonwords, which should share the same semantic/non-semantic distinction that concrete and abstract pictures have, did not find more false alarms for words than for nonwords for older adults. Memory for words versus nonwords also was not significantly different between young and older adults (Perfect & Dasgupta, 1997), indicating that older people did not have a greater reliance on semantic information as a perceptual/conceptual distinction theory would predict. Finally, older adults have been shown to use perceptual details to the same extent as younger adults on a “meaning recognition” task (Koutstaal, 2003).
Thus, there are conflicting results in the literature regarding older adults’ ability to use perceptual information in episodic memory tasks. Experiment 1 further examined this question by manipulating perceptual details in a task that held semantic information constant. The experiment used stimuli consisting of words and pictures that represented concrete objects. The pictures had distinctive perceptual features, whereas the perceptual features of the words (i.e., letters) were relatively generic. In a recognition memory task, participants were forced to use recollective memory processes by the presence on the test list of “lure” items that represented the same semantic content as items on the study list, but with different perceptual features (e.g., a picture of a bowl on the study list, and the word “BOWL” on the test list). This technique assumes that the picture of an object and the word referent for an object activate the same concept in the semantic network (Carr, et al., 1982).
Participants were instructed to identify a stimulus as “old” only if they saw the exact stimulus on the study list. If older adults are specifically impaired in their processing of perceptual information, then their performance should be especially bad for items that have generic perceptual features (i.e. words) because older adults are unable to make the fine-grained distinctions necessary to correctly identify words as “old” or “new.” Memory for items with very distinctive perceptual features (i.e., pictures) should be relatively preserved for older adults, since the damage to perceptual processing would less effectively wipe out discriminability of those items. If, on the other hand, information content is orthogonal to the age-related memory deficit, then older adults should be equally impaired on memory for words and pictures relative to younger adults.
2.2 METHODS
2.2.1 Participants
A specific effort was made to improve on previous studies by recruiting older adults who were representative of the general aged population. Sixty-one older adults, 41 females and 20 males (mean age = 82.2 years, range = 61-96; mean education = 13.8 years, range = 9-20 years), were recruited from the Pittsburgh region, including retirement communities and churches. The older adults received $7.00 compensation for participation.
Ninety young adults, 54 females and 36 males (mean age = 21.2 years, range = 18-39 years; mean education = 14.3 years, range = 12-23 years), were recruited from the University of Pittsburgh community and Introductory Psychology courses. The young adults received either
$7.00, Psychology course credit, or extra credit for participation.
A core group of 34 young people and 37 old people participated in three experiments: Experiments 1, 2, and 3. An additional 56 young people and 24 older adults also participated in Experiments 2 and 3 (total each for Exps. 2 & 3 = 90 young & 61 older). Experiment order was randomly assigned to avoid order effects.
All participants were native English speakers, right-handed, and had no history of major medical, neurological, or psychiatric disorders. After the explanation of procedures and prior to
testing, all participants provided written informed consent to participate using consent forms approved by the Institutional Review Board of the University of Pittsburgh.
2.2.2 Stimuli
Stimuli consisted of 95 words presented in black uppercase lettering against a white screen and 95 objects presented as black line drawings against a white screen (pictures; Snodgrass & Vanderwert, 1980). A pilot study with both older and young adults was conducted in order to determine the word referent of each member of the picture corpus. Pictures that produced multiple word referent variants (e.g., sofa, couch, davenport, loveseat, settee) were excluded from Experiment 1.
2.2.3 Design
Thirty-seven of the word stimuli and 37 of the picture stimuli were presented in random order, alternating word/picture for each participant during the study session. For the test session, 57 words and 57 pictures alternated (114 stimuli total, at test). The randomly ordered test list containing 19 items in each of the following conditions: word targets, picture targets, word lures, pictures lures, word distractors and picture distractors (See Table 2 in Appendix A).
2.2.4 Procedure
During the study session, participants were presented with a sequence of single pictures and words on the computer screen. Stimuli were presented until the participant responded or for a maximum of 5000 ms. After participants responded to each stimulus, another stimulus would
appear. During the study session, participants were instructed to make a decision about the stimuli presented (e.g., “pleasant or unpleasant”). Making a judgment about the pleasantness of an item requires consideration of semantic properties and has repeatedly been shown to increase encoding and attention to the study stimuli (Hyde & Jenkins, 1969; Craik & Lockhart, 1972; Hyde & Jenkins, 1973). It was assumed that the pleasantness ratings would not result in any differences in emotional processing between age groups.
Participants were informed that they would be asked about the stimuli later in the experiment. Participants proceeded immediately from the study session to the test session instructions in which participants were instructed to make an “old/new” decision task. They were told that a “yes” response was to be given only if there was an exact physical match to previously seen study items. Test items that matched study items only in semantic information but not perceptual information (i.e., not identical physical matches) were to be considered “new” and served as lures. Test items that did not match the items at study semantically or perceptually were to be considered “new” and served as distractors. Trial sequence for study and test sessions are in Table 2 of Appendix A. After the participant pressed the space bar a new stimulus (word or picture) appeared, which remained until the participant made a response, or for a maximum of 3000 ms.
The experiment took place in true-to-life settings in retirement homes, apartments, and campus classrooms or offices. Lab settings were purposely avoided when testing the young subjects because the older adults were not tested in lab settings. The testing environment was always an isolated room with closed doors to decrease distraction. Each participant viewed the trials on a laptop computer screen in the testing room, while the experimenter was present in the room to ensure that participants did not progress to the next section of the experiment before they
were required to do so. The experimenter was present in the room because in pilot studies, both young and older adults often failed to obey the instruction screen that stated, “STOP! ALERT EXPERIMENTER,” despite repeated verbal instruction prior to the start of the experiment.
2.2.5 Analytic technique
Standard signal detection measures of hits (“yes” responses to targets) and false alarms (“yes” responses to lures and/or distractors) were used in the analyses of data for this experiment (MacMillan & Creelman, 1991; Green & Swets, 1966). For some analyses the difference between hits and false alarms was used as a measure of discrimination between old and new items.
2.3 RESULTS
Reaction times were displayed as box plots and subjects who consistently had reaction times (across multiple conditions) that were outliers were excluded. An outlier was defined as a reaction time that was more than 1.5 times the box length (interquartile range) away from the bottom or top edge of the box. Older adults had slower reaction times than young adults overall (t(59)= -6.02, p<.001, Cohen’s d=1.57). Mean RT for young adults was 1191 ms and for older adults was 1729 ms. For some conditions the older adults did not have enough correct responses (i.e., word lures) and for some conditions the young adults did not have enough incorrect responses (i.e., picture targets). Therefore, for each subject the median reaction times for each condition were averaged for all response types for which there were more than three responses.
It was expected that older adults’ accuracy would be worse overall than the young adults’ accuracy and that the older adults would benefit from the additional perceptual details available in the picture condition (over the word condition) and would do so to a greater extent than young adults. This was expected because according to the perceptual impairment hypothesis, older adults are not able to process perceptual cues as well as younger adults. Thus, an excess of unique perceptual cues in the picture condition as compared to the word condition should help the older adults and it should help them more than it should help the younger adults who are not impaired at perceptual processing. Finally, older adults should have a greater increase in false alarms for the lure condition than the distractor condition because the lures require more reliance on perceptual information (i.e., the lures have the same degree of semantic familiarity as the targets so semantic familiarity cannot distinguish lures from targets).

A 2 (condition) X 2 (stimulus format) X 2 (age group) split-plot univariate analysis of variance (ANOVA) was performed on the old/new discrimination data (hits minus false alarms) for the young (n=29) and older adults (n=32), with condition and stimulus format as within- subjects factors and age-group as a between subjects factor. This was conducted across the two false alarm conditions, lures and distractors, and the two stimulus forms, pictures and words, and across the two age groups, young and old.1 As expected, young adults had better old/new discrimination than older adults (main effect of age) (F(1,59)=71.02, p <.001, η2=.546). Also as expected, older adults benefited from the additional perceptual cues available from pictures more than young adults did (age X form interaction) (F(1,59)=27.45, p<.001, η2=.318). As predicted, older adults had a greater difference in false alarms between lures and distractors than young adults did (age X condition interaction) (F(1,59)=19.31, p<.001, η2=.247. Lastly, there was an
1 All effects and interactions were significant (between age groups and all within-subjects effects and interactions)
p<.001.
age group X form X condition interaction (F(1,59)=11.19, p=.001, η2=.159. The extent to which older adults had a greater benefit of pictures than young adults was seen more in the comparison of targets to lures than in the comparison of targets to distractors. This is illustrated in Figure 1. Unlike distractors, lures lacked novel semantic information that older adults could use and this affected their responses to words more than to pictures. The nature of this interaction can be viewed in Figure 2.
Figure 2 shows false alarms for lures relative to distractors – the distractor false alarms provide a baseline for false alarms in general, and allow for comparison across conditions and age groups. Remember that use of the perceptual details is essential for identifying an item as a lure since the lures share conceptual details with the targets but they do not share perceptual details. The lure conditions tested whether participants could use perceptual details to reject items that were semantically identical to studied items. If perceptual processing (encoding or retrieval) is impaired, then older adults should have more difficulty rejecting word lures than picture lures because words have less distinctive perceptual characteristics than pictures. The increased false alarm rate for lures over and above distractors indicates the extent to which participants failed to use perceptual details to correctly reject items. That is, how much does having only new perceptual details impair identification of a lure more than having new perceptual and new conceptual details (distractor condition).
Younger adults had about the same increase in false alarms for lures regardless of the physical format of the lure. Older adults, on the other hand, made many more false alarms to word lures than to picture lures (relative to the distractors).
1.00
.90
.80
.70
p(Hits) – p(FA) .
.60
.50
.40
.30
.20
.10
.00
Words Pictures
Stimulus Type
Figure 1. Old/new discrimination for young and older adults. Error bars represent standard error of
the mean.
.35
p(FA – Lures) – p(FA – Distractors) .
.30
.25
.20
.15
.10
.05
.00
Words Pictures
Stimulus Type
Figure 2. False alarms for words and pictures for young and older adults. Error bars represent
standard error of the mean.
2.4 DISCUSSION
According to the perceptual impairment hypothesis, recollection critically depends on the encoding and retrieval of unique perceptual characteristics of the original episode in order to allow for reconstruction of the episode later. Recollection and familiarity might depend on both perceptual and conceptual information, but familiarity would not necessary fail for lack of perceptual details while recollection would. If older adults are impaired in processing of perceptual details, then in a task where the use of perceptual information is necessary to make memory judgments, the older adults’ memory impairment (relative to young) should be less severe for perceptually distinctive items and more severe for perceptually generic items. Word memory should be more impaired than picture memory because perceptual deficit will hurt visual distinctiveness for words more than for pictures, which have many more distinctive perceptual features. If the perceptual distinctiveness of stimuli is manipulated while keeping semantic/conceptual information constant, we should be able to observe any differences in performance due to impaired processing of surface/perceptual features. Experiment 1 found that older adults were impaired by the absence of unique perceptual details much more than young adults. This lends supports to the hypothesis that older adults are processing perceptual details less effectively than young adults, especially when perceptual details are sparse as is the case with words.
3.0 EXPERIMENT 2
3.1 RATIONALE
Experiment 2 will test whether a problem with ensemble encoding causes age-related memory deficits. The ICE (item-context-ensemble) model explains age related deficits as an impairment of ensemble formation at encoding, or the ability to encode features of the study event that represent integrative information about item and context. The results of studies that manipulate encoding strategies are consistent with ICE because these experiments improved older adult performance by providing more time or encouragement for them to elaborate on the relationships between item and context information during the study sessions. If ensemble encoding is specifically impaired in older adults, then memory should be affected by manipulations of the relationship between item and context information. Only one study has been done that specifically tests this prediction of the ICE model in older adults (Bayen, et al., 2000). That study found that young adults, and not older adults, performed better during recognition tasks in which study items were embedded in rich visual contexts, such as full visual scenes, than when they were in simple visual contexts. Older adults presumably did not show this benefit because they did not use the extra context information in ensemble formation (whereas the young adults did). Larger differences between older and young adults have also been found in a cued-recall task when the item and the context were unrelated than when they were related, possibly because it is harder to make an ensemble when the context and item are unrelated (Park, etal., 1990;
Smith, etal., 1998). Neither of these findings is readily explained by a specific deficit in controlled versus automatic processing or perceptual versus conceptual processing.
Recent studies (Criss & Shiffrin, 2005) have suggested that the formation of memory traces that use ensemble information occurs in paired-associate memory as well as item-context memory. That is, individuals encode integrative information about both items in a pair in a manner similar to the encoding of integrative information about an item and its surrounding context. If a deficit in forming integrative associations between item and context is to blame in older adults’ impaired recollection, then this deficit in forming associations should also be seen in paired-associate memory.
3.2 METHODS
3.2.1 Participants
Sixty-one older adults and 90 young adults participated in Experiment 2. All of these people also participated in Experiment 3. Of the 61 older adults and 90 young adults who participated in Experiments 2 and 3, 37 of the older adults and 34 of the young adults were the same people who participated in Experiment 1. Experiment order was randomly assigned to avoid order effects.
3.2.2 Stimuli
The study used standardized black and white photographs of faces (see Criss & Shiffrin, 2005, for standardization details) and abstract words (Ex: incident) of varying environmental frequency
(M=18.59, range=1-245, SD=24.32; Kucera & Francis, 1967) and low imageability (M=341.69, range=129-400, SD=43.13; Colthart, 1981). The set of words did not include any words that might describe a face, a person, or a characteristic of either.
3.2.3 Design
The design of the study and test lists are illustrated in Table 3 in Appendix A. The conditions differ in the repetition both of individual items and pairs of items. Test pairs in the List 2 condition were composed of items that were seen in pairs on the second study list only. Test pairs in the Lists 1 & 2 Re-arranged condition consisted of items that were seen in pairs on both study lists, but whose pairings changed from one list to the other list. Test pairs in the Lists 1 &
- Exact condition consisted of items that were seen on both study lists, in the same pair combination on each of the study lists. The other conditions (List 1 Exact and List 1&2 Re- arranged) were used as controls.
3.2.4 Procedure
The location and computer equipment were the same for this experiment as for Experiment 1. Participants received two study lists. The first study list contained 52 pairs of items and the second contained 60 pairs. On each trial of each list, participants performed an incidental task that involved rating each pair on the following question: “Are these items pleasant or unpleasant?” Items were presented until the participant responds or for a maximum of 5000 ms. Each study trial were separated by a 500 ms inter-stimulus interval (ISI). At the end of the first list, participants were reminded that they have just seen the first of two study lists. Participants were given a three minute break during which they completed a number search task and then
advanced to the second study list, which was presented in the same manner as the first study list. Following the final study list, participants engaged in a 1 minute math task before being informed that they would take an unexpected memory test. Prior to the presentation of this 72 trial test list, participants were given examples of all the possible types of targets and lures and instructed to respond “yes” only if they have seen intact pairs from List 2 during the study session and to respond “no” to all other pairs.
3.2.5 Analytic technique
Standard signal detection measures of hits (“yes” responses to targets) and false alarms (“yes” responses to lures and/or distractors) were used in the analyses of data for this experiment (MacMillan & Creelman, 1991; Green & Swets, 1966). For some analyses the difference between hits and false alarms was used as a measure of discrimination between old and new items.
3.3 RESULTS
The same exclusion procedure for outliers used in Experiment 1 was used in Experiment 2. Older adults had slower reaction times than young adults for both correct (t(132)= -5.81, p<.001, Cohen’s d=1.05) and incorrect responses (t(132)= -2.90, p=.004, Cohen’s d=.52). Correct response mean RT for older adults was 2192 ms and mean RT for correct responses for young adults was 1730 ms. Mean RT for incorrect responses for older adults was 2165 ms and for young adults was 1922 ms.
A 4 (condition) by 2 (age-group) split-plot univariate analysis of variance (ANOVA) was performed for the young (n=84) and older adults (n=50), with condition as a within-subjects factor and age-group as a between subjects factor. For each of the four conditions, a measure of old/new discrimination was calculated by subtracting false alarms from hits. Figure 3 shows hits minus false alarms (i.e., old/new discrimination) in three conditions. In “Lists 1 & 2 Exact,”- a test pair was studied twice. In “Lists 1 & 2 Rearranged,” twice-studied items were studied only once in pair form (on the 2nd list) and the individual items appeared once (on the 1st list paired with other items). In “List 2 Only,” the items/pair were studied once (only on List 2, only in pair form). There was a small main effect of condition, F(2.97, 392.52)=6.39, p<.001, η2=.046, and a very small condition by age group interaction, F(2.97, 392.52)=4.37, p=.005, η2=.032, using the conservative Greenhouse-Geisser correction due to violation of the sphericity assumption (that the variance of the difference scores in a within-subjects design are equal across all the groups). There was also a main effect of age group, F(1,132)=45.06, p<.001, η2=.254.
The main effect of condition was driven by the young adults. In the paired sample t-tests the old/new discrimination differed between conditions (p<.01) for all comparisons except the comparison of conditions “Lists 1&2 Rearranged” and “List 2 Only”. Older adults did not have any condition effects which is the source of the condition by age group interaction. The nature of the interaction can be seen in Figure 3. Young adults’ old/new discrimination was significantly improved in the Lists 1&2 Exact condition relative to the Lists 1&2 Rearranged and the List 2 Only conditions, whereas the older adults’ old/new discrimination did not differ across conditions and was overall worse than young adults. The improved performance of the young adults in the Lists 1&2 Exact condition represents a specific benefit of pair repetition. The lack
of benefit of pair repetition for the older adults suggests that they did not use associative information about pairs in their memory decisions.
Because some of the subjects in Experiment 2 did not participate in Experiment 1, a second analysis was performed excluding the people who did not participate in Experiment 1. Of the people who participated in Experiment 2, there were 32 young and 32 older adults who participated in Experiment 1. There was a main effect of condition (F(2,124)=3.35, p=.038, η2=.051, but the condition by age group interaction was marginally significant (F(2,124)=2.98, p=.054, η2=.046. There was also a main effect of age group (F(1,62)=20.17, p<.001, η2=.245. Note that this effect size for age group in this analysis of only the subjects who participated in both Experiment 2 and Experiment 1 is equivalent to that in the larger group of all subjects who participated in Experiment 2 (η2=.254).
For this additional analysis, older adults had slower reaction times than young adults for both correct (t(62)= -4.97, p<.001, Cohen’s d=1.26) and incorrect responses (t(62)= -2.32, p=.024, Cohen’s d=.59). Correct response mean RT for older adults was 2354 ms and mean RT for correct responses for young adults was 1803 ms. Mean RT for incorrect responses for older adults was 2281 ms and for young adults was 1988 ms. Figure 3 shows the results for the more inclusive analysis, not for the second analysis detailed above.
.40
.35
.30
p(Hits) – p(False Alarms) .
.25
.20
.15
.10
.05
.00
Lists 1 & 2 Exact Lists 1 & 2 Rearr List 2 Only
Condition
Figure 3. Old/new discrimination across three conditions for young and older adults. Error bars represent standard error of the mean.
3.4 DISCUSSION
According to the associative encoding theory of impairment, older adults are specifically impaired in the ability to form links between items and their contexts. Associative encoding might be critical to recollective-type memory because it enables the reconstruction of other information surrounding the item in the original episode, possibly in the form of extra features in the memory trace. Experiment 2 used pairs of words and faces to evaluate associative encoding. A recent study (Criss & Shiffrin, 2005) found that young people do use associative information in memory for pairs (not just individual item information), so if the age-related memory impairment is due to an inability to encode associative information between items and their
contexts, then this impairment should also be seen in the encoding of associations between multiple items (e.g., paired-associate memory). The young people benefited from repetition of pairs, over and above any benefit of item repetition, but older adults showed no such benefit. In addition, older adults were worse overall at pair memory. Both findings indicate a deficit for associative encoding.
4.0 EXPERIMENT 3
4.1 RATIONALE
Experiment 3 attempted to replicate the alleged controlled processing deficit in older adults using a traditional process-dissociation paradigm. The purpose of Experiment 3 is for use as a baseline for the other two experiments since the process-dissociation framework has been so frequently used and the controlled processing deficit is the most common explanation for older adult memory impairment.
The controlled process thought to contribute primarily to recollection consists of an active search through memory traces of previously studied items for comparison to each test item (as opposed to an automatic evaluation of the global familiarity of each test item; Yonelinas, 2002). Typically in experiments that use the process-dissociation procedure it has been found that older adults’ performance is based less on recollection than young adults’ performance, but that both groups rely equally on familiarity (Dywan & Jacoby, 1990; Jennings & Jacoby, 1997; Titov & Knight, 1997).
The experiment used a process-dissociation procedure in order to identify the separate contributions of the putative controlled and automatic processing mechanisms. If both types of mechanisms occur in normal memory function, then they should both contribute in a recognition memory task. The process-dissociation procedure enables the researcher to estimate the contributions of each by using two different memory tests that tap the processes in different
ways. A standard process-dissociation paradigm is to present two study lists to participants, one after another. During an inclusion test, participants are instructed to respond “yes” to any previously studied item, regardless of which study list it was on. In this case the controlled and automatic processes collaborate to produce a successful retrieval. During an exclusion test, participants are instructed to respond “yes” only to items from one of the study lists. In order to successfully complete the task, participants are required to reject familiar, recently studied items that did not appear on the target list. As a result, the automatic and controlled processes oppose one another and an index of recollection can be calculated by comparing data from the inclusion and exclusion tasks.
4.2 METHODS
4.2.1 Participants
Sixty-one older adults and 90 young adults participated in Experiment 3. All of these people also participated in Experiment 2. Of the 61 older adults and 90 young adults who participated in Experiments 2 and 3, 37 of the older adults and 34 of the young adults were the same people who participated in Experiment 1. Experiment order was randomly assigned to avoid order effects.
4.2.2 Stimuli
The study used the same database of abstract words detailed in Experiment 2, but none of the words were duplicates of those used in Experiment 2.
4.2.3 Design
Ninety-six abstract words were divided into four lists of 24 words. Two of the lists were randomly chosen to be study lists and the items on the other two lists were used as distractors during the test tasks. Every word on the two lists presented at study was a target word. All the target words were presented at test, but half were presented in the inclusion task and the other half in the exclusion task. The inclusion and exclusion tasks contained distractor words: thus, both the inclusion and exclusion tests consisted of 24 studied words (12 targets from each study list) and 24 new words (distractors).
4.2.4 Procedure
The location and computer equipment were the same for this experiment as for Experiments 1 &
2. Participants received two study lists and they were asked to complete an incidental encoding task that involves a pleasantness rating. Items were presented until the participants responded or for a maximum of 5000 ms, with a 500 ms inter-stimulus interval (ISI). At the end of the first list, participants were reminded that they had just seen the first of two study lists. Participants were given a three minute break during which they completed a number search task and then advanced to the second study list, which were presented in the same manner as the first study list. Following the final study list, participants engaged in a 1 minute math task before being informed that they were taking an unexpected memory test. The participant received either an inclusion or an exclusion memory test. Before taking the test, participants were given verbal instructions and were also able to read them on the computer screen. In the inclusion test, participants were asked to respond “yes” if they have seen the word during the study session and
“no” if the word is new. The exclusion task instructions were identical except that participants were asked to respond “yes” only to words from a specific study list rather than all words from the study session and to respond “no” if a word is from the non-specified list or is a new word. Presentation of the study lists, and assignment of study lists to inclusion or exclusion task were counterbalanced.
4.2.5 Analytic technique
“Yes” responses to old items (List 1) in the exclusion task are false alarms and are assumed to result from dependence of only familiarity, not recollection (F only, no R) because using recollection would result in a correct rejection, whereas “yes” responses to List 1 items in the inclusion task are correct responses and are assumed to result from the contribution of either recollection or familiarity or both ((F+R)-(F*R)). The probability of R can be obtained by subtracting the probability of F only (exclusion “yes” responses) from the total probability of F or R (inclusion “yes” responses). Once the probability of R is derived, it can be used to calculate the value for F. “Yes” responses to List 1 items in the exclusion task reflect F only without R, thus false alarms = F-F*R. Solving the equation for F results in FA/(1-R) and R is already known from the previous calculation.
4.3 RESULTS
The same exclusion procedure for outliers used in Experiment 1 was used in Experiment 2. Older adults had significantly slower reaction times for correct responses than young adults
(t(129)= -8.15, p<.001, Cohen’s d=1.48). Correct response mean RT for older adults was 1316 ms and mean RT for correct responses for young adults was 996 ms.
Jacoby’s process-dissociation procedure (1991) was used to create values of R (recollection) and F (familiarity) for each subject. The parameter for R was computed by subtracting proportion of “yes” responses to List 1 items in the exclusion task from proportion of “yes” responses to items in the inclusion task. The parameter F was computed by dividing the proportion of “yes” responses in the exclusion task by 1-R. This was done for each subject. In Figure 4, recollection (R) and familiarity (F) parameters were derived by comparing the inclusion and exclusion tasks. There was a main effect of age; young people had significantly higher values on both recollection and familiarity than older adults. There was also a main effect of memory type, the familiarity parameter value was greater than the recollection parameter value for both groups. Surprisingly, however, the expected interaction of age and memory type was not seen. A 2 (memory parameter) X 2 (age group) univariate split-plot ANOVA was performed for the young (n=80) and older (n=50) adults, with memory parameter as the within- subjects factor and age group as the between-subjects factor.
There was a main effect of memory parameter F(1,128)=388.07, p<.001, η2=.752 and a main effect of age group F(1,128)=96.20, p<.001, η2=.429 but the interaction was not significant, F(1,128)=2.17, p=.143, η2=.017. The familiarity parameter was larger than the recollection parameter, for both age groups. Older adults had significantly smaller memory parameters overall, but were not specifically impaired on recollection compared to young adults.
Because some of the subjects in Experiment 3 did not participate in Experiment 1, another analysis was performed excluding the people who did not participate in Experiment 1. Of the people who participated in Experiment 3, there were 31 young and 33 older adults who
participated in Experiment 1. The results were the same, no interaction was present F(1,61)=.002, p=.969, η2<.0001 but there were main effects of memory parameter F(1,61)=263.2, p<.001, η2=.812 and age group F(1,61)=, p<.001, η2=.337. Note that the effect size for the age group parameter is similar for this smaller group that participated in both Experiment 3 and Experiment 1 (η2=.337) and for the larger group of all Experiment 3 participants (η2=.429), regardless of whether they participated in Experiment 1.
In this subset, older adults had significantly slower reaction times for correct responses than young adults (t(61)= -5.30, p<.001, Cohen’s d=1.36). Correct response mean RT for older adults was 1333 ms and mean RT for correct responses for young adults was 1004 ms. For the inclusion task, some subjects did not have enough incorrect responses to compute reliable median RT so the RT for each subject was the average of median RT only for correct responses across the two conditions.
.90
.80
.70
.60
Parameter value
.50
.40
.30
.20
.10
.00
Recollection Familiarity
Condition
Figure 4. Recollection and familiarity parameters for young and older adults. Error bars represent
standard error of the mean.
4.4 DISCUSSION
The most commonly accepted explanation for the episodic impairment in healthy older adults has been put forth by Jacoby (1991). His hypothesis is that aging decreases controlled processing ability, that is, the ability to do tasks that require the allocation of attentional resources. According to this view, recollective memory requires controlled processing whereas familiarity is supported by automatic processes that do not require attentional control. This hypothesis has been researched extensively by others often making use of an experimental design called the process-dissociation procedure (Jacoby, 1998) which teases out the respective contributions of recollection and familiarity to memory performance.
If the age-related memory impairment is due to degradation of attentional functions that support strategic memory search, then there should be larger differences between old and young adults for tasks that rely on recollection compared to tasks that rely on familiarity. Here, controlled processing was not specifically tested, but the process-dissociation procedure was used to provide a baseline for age-related differences among the current participant sample by which to judge the results of the other experiments.
In the process-dissociation paradigm there are two types of tests. In the inclusion test, the participants must say “yes” to items from either study list and it is believed that recollection and familiarity are working together in this task (Jacoby, 1991; Jacoby, 1998; Hay & Jacoby, 1999). In the exclusion test, the participants must say “yes” only to items from the second study list and it is believed that recollection and familiarity are working against each other in this task. Therefore, incorrectly including List 1 items in the exclusion task is evidence of the reliance on familiarity instead of recollection because recollection is an all-or-none process.
Determinants of the Aggregate Inward FDI Flow to Pakistan
The difference between older and young adults for recollection was not significantly bigger than the difference between older and young adults for familiarity. This finding is inconsistent with several previous findings in studies which used the same process-dissociation procedure (Hay & Jacoby, 1999; Jennings & Jacoby, 1993; Jennings & Jacoby, 1997). When using the process-dissociation procedure to separate the relative contributions of recollection and familiarity, older adults have shown greater impairment in recollection than for familiarity compared to young adults. Those studies differed in regard to the modality of each list the and more notably the instructions given to the participants for the study session. In one of the studies (Jennings & Jacoby, 1993; Exp. 2) items were given to the participants as text on one list and verbally on the other list. That is, the lists differed on perceptual details, while the current study had the same
CHAPTER 1:
INTRODUCTION
Overview
Globalization which gave birth to the concept of interdependence of countries and their economies has been defined as the process through which regional economies, societies, and cultures have become integrated with the assistance of global network of trade, communication and transportation. This allowed the investors to invest or transfer their capital where ever they wanted which introduced the concept of Foreign Direct Investment. Since the recent financial crisis in Asia and Latin America developing as well as newly industrialized countries have been advised to rely mainly on FDI for economic development and supplement national savings by capital inflows. Developing countries in particular are in need of investment for their development and the investment amount in majority of cases is greater than the capital internally available. Therefore, FDI has emerged as most important source of generating capital required for development of emerging countries. Currently Foreign Direct Investment has become one of the major sources of economic development, modernization, employment, income growth, capital generation and a channel for the transfer and access to advance technologies as well as organizational and managerial skills.Recognizing this fact, developing countries try their level best to attract as much as of FDI as they can. But attracting FDI is not that much simple, it requires huge efforts on the part of policy makers and government.Variety of factors is considered by an investor before making investment in a particular foreign country. Those were labeled as determinants of FDI, and may vary from country to country. Pakistan is currently facing a huge shortfall of capital to finance its major development projects and to run the government operations smoothly.The country requires capital to fulfill the growing needs in defense, infrastructure, education and variety of other aspects of serioussignificance to progress.
Since 1990s there has been noteworthy increase in flow of capital investments to developing countries, which motivateddiscussions in literature concerning determinants of such investment flows.This trend was result of liberal trade policies, variations in economics related fundamentals of emergent countries, development of capital markets and transformations in economic conditions around the globe.This research paper tries to investigate the role of economic fundamentals in driving investment flows.Past research on the economic fundamentals as determinants of foreign direct investment divided economic fundamentals into two broad categories of pull factors and push factors. Push factors were considered as those economic fundamentals that relateto industrial or developed countries and motivate capital flows,in contrast pull factors consist of economic fundamentals of recipient countries that attract capital flows.One of the major push factors as cited in the past research was hold back of the economies of the developed countries (Calvo, 1992; Fernandez-Arias, 1996; Haque, 1997; Montiel and Reinhart, 1999).Pull factors consist of Supply of money and local productivity of the recipient country (Calvoet al., 1992; Lensink and White, 1998). Calvoet al. (1992)argued that push factors contribute more than pull factors ingrowth of capital transfer.Vita and Kyaw (2008) suggested that variations in domestic yield and productivity of the foreign country were main determinants of portfolio and FDI flows.Dunning (1993) by combining previous research on the determinants of FDI came up with “OLI� model that stated global manufacturing as function of ownership, localization and internationalization.Variety of theories have been developed regarding the determinants of FDI such as industrial organization theory, the pure trade theory, classical theory relating international investment flows, and locational factor theories.Classical theory relating the international investment flow states that when return on investment crossways countries under autarchy change the investments will shift from lower to higher return providing country. Therefore, this theory assumes foreign direct investment as function of dissimilarity of return on investment.Wilhborg (1978)argued that volatility in the exchange rate would decrease the amount of portfolio investment and that had also been valid for FDI(Black, 1977). According to Kohlhagen (1977) the firms that expect devaluation in the currency of foreign country would defer its investment till the time when exporting becomes profitable. Study also concluded that the higher the exchange rate, the lower the amount of FDI because this phenomena would make exporting relatively less profitable.
1.2 Problem statement
To identify the best determinants of the aggregate inward FDI flow to Pakistan.
1.3 Hypothesis
This particular research primarily focused on testing the following hypothesis:
H1: GDP has positive impact on FDI.
H2: Infrastructure expenditure has positive impact on FDI.
H3: Taxes has negative impact on FDI.
H4: Inflation has negative impact on FDI.
H5: GDP per capita growth has positive impact on FDI.
H6: Exchange rate has positive impact on FDI.
H7: Interest rate has negative impact on FDI.
1.4 Outline of the Study
The first chapter of the research focuses on giving basic view of the research and provides information on the overview, issues, purpose and basic theories on the determinants of FDI. In the chapter existing work done by various researchers and past empirical studies have been discussed. The third chapter provides details regarding practical carrying out of the research and describes data collection and analysis procedures. Finally, the last chapter gives details regarding the results of the research.
1.5 Definitions
All the chosenfor predicting FDI were variables that had been used in prior researchand theories relatingFDI.
1.5.1 Net Foreign Direct Investment (FDI)
The net amount of foreign direct investment received by Pakistan measured in current US dollars.
1.5.2 Inflation (I)
The variable represents annual change (%) in the commodities that fall in the category of CPI.
1.5.3 Interest rate (IR)
The variable represents the annual rateof interest (%) offered by banks operating in Pakistan on the deposits by customers.
1.5.4 Exchange rate (ER)
Measured as the rateof converting 1 US $ into Pakistani rupees (1 US $ = Rs.).
1.5.5 Infrastructure expenditure (IE)
Represents the annual amount spent by government on Pakistan on the development of infrastructure in the country. The variable is measured by annual amount of Public Sector Development Program (PSDP) fund and unit of measurement was rupees in million.
1.5.6 Taxes (T)
The variable represents the annual rate of tax (%) applicable on the profits of corporate companies operating in Pakistan.
1.5.7 Gross domestic product (GDP)
Represents the total value of goods and services (at factor cost) produced in Pakistan measured in Rs. Million.
1.5.8 GDP per capita growth rate (GDPG)
The variable represents the annual rate of growth (%) in the gross domestic product per capita, of Pakistan.
CHAPTER 2:
LITERATURE REVIEW
A lot of research has already been conducted in the field of identifying the best determinants of Foreign Direct Investment by various researchers. Most of the research work conducted implies that the determinants of Foreign Direct Investment vary from country to country and from location to location. The purpose of this research is to find out the impact of Labor cost (Wage), Inflation (I),Interest rate (IR), Exchange rate (ER), Infrastructure expenditure (IE), Taxes (T), GDP and GDP per capita growth (GDPG) on Foreign Direct Investment (FDI) inflow in Pakistan. The study hypothesizes positive relationship between GDP, GDP per capita growth, Infrastructure expenditure and Exchange rate with FDI whereas Wage, inflation, Taxes and Interest rate relate negatively with FDI.
Pursuing the same objectives Kok and Ersoy (2009) conducted study that made attempt to investigatethe best determinants of FDI in developing countries. Study hypothesized and concluded that GDP, inflation, Trade, GDP per capita growth,Gross fixed capital formation and communication (telephone) are positively related with FDI whereas inflation and total debt/ GDP had negative relationship. Barrel and Pain (1996) in their empirical studies found that FDI and both the acceleration and level of GNP were positively related. In addition unit labor cost and relative capital cost also had positive relationship with outward direct investment. Research suggested that in short run funds availability affects investment timing. Research of Barrel and Pain et al.related to this particular thesis because it tried to identify probable impact of factor prices and demand across countries, as well as exchange rate expectations in determining the total level of foreign direct investment (FDI) by United States companies. According to Janeba (2002) investment costs and government credibility has significant impact on the level of inward foreign direct investment, suggesting that MNCs would prefer to invest in politically stable countries. The research also concluded that when any politically unstable country has cost advantage over other countries MNC will invest efficient amount in that particular country and will hold excess capacity elsewhere. According to the conventional wisdom lack of commitment from the government discouraged foreign direct investment in emerging countries.The research work done by Harvey (1990) focused on the macroeconomic determinants of FDI in addition to variables relating to different industry groups and tried to identify the impact of these variables on the inward FDI flow of the recipient country. Research suggested that Exchange rate and Sales had significant impact on the foreign direct investment, whereas taxes did not have any significant role in explaining foreign direct investment.
Following bit different framework research conducted by Rolfe, Ricks, Pointer and McCarthy (1993) made an attempt to check investors’ investment decision on the basis of various investment incentives provided by countries in the Caribbean region. The study demonstrated that all inducements do not evenly plea to all investors. The investment characteristics would determine which incentives firm manager will prefer. According to the study incentives chosen by firms exporting their productsvary from those firms that sale product in local markets, companiesopening operations in a new state had different inducement preferences than firms involved in growing or purchasingprevailing operations, incentive choicesoccasionally differ by state of investment, incentives varyreliant upon the products made, large financiersselect different motivations than those preferred by smaller companies and incentive inclinations can fluctuate on yearly basis. In short the research concluded that incentive preferences can be represented as a function of the investment type, countries involved, the market positioning of the investing companies, type of products produced by the investing company, amount of the capital invested, and investment time.
Terpstra and Yu (1988) tried to examine the impact of firm-specific advantages and locational factors on the foreign investment made by advertising agencies of U.S. Study focused ondetermining role of market size of recipient country, geographic nearness of recipient country, size of the investing firm, experience of investing firm in international operations, oligopolistic response and existence of homemade country clientelesoverseason FDI. The research depicted that U.S. advertising agencies prefer to invest in those foreign countries having large market size, did not discriminated countries on the basis of their geographic location, inclined to enter foreign market with bigger firm size, tended international expansion with increasing understanding of international operations, reacted oligopolistically while making foreign investment and followed client firms belonging to home country while going abroad. Additionally research found that oligopolistic reaction had stronger impact in 1984 compared to 1972, intensity of competition had significant impact on oligopolistic reaction and top agencies witnessed stronger impact of oligopolistic reaction.
Another study tried to examine determinants of FDI by using macroeconomic variables but more emphasis was given to various ratios relating to capital and labor, it also used “The Heckscher-Ohlin Theoryâ€? which stated that a country exports those commodities that intensively use the country’s relatively abundant factors and imports those goods using its scarce factors intensively. Results indicated that countries like U.S. imported goods whose production required higher capital to labor ratio than the goods exported and when the endowment ratio of capital/labor increased the ratio of capital for each worker in import-competing production to capital for each worker in export production declined.Gopinath and Echeverria (2004) studied the association between foreign investment (FDI) and trade in mutualframework, that is, source or investing country’s exports and foreign investment toinvestment recipient country wereexaminedthrough gravity-model methodology. Results suggested that physical distance had negative impact on trade-FDI ratio, this caused nations to switch from export to FDI based manufacturing. Research also found GDP per capita to affect trade-FDI ratio positively and institutional quality strongly encouraged FDI, additionally FDI was also encouraged by regional trading agreements.
The empirical study conducted by Goldberg and Kolstad (1995) stated that exchange rate instability contributed to production internationalization without depressing economic activity in the home country. Furthermore, exchange rate instability motivated the portion of investment activity situatedin foreign state. Research also suggested that exchange rate instability did not have statistically dissimilar effects on capital investment shares when distinguished between varieties of periods where real or financialvariations dictated exchange rate movement.Yin (1999) made an attempt to study the impact of tax inducements on the arrangement of a localbusinesswith respect to price, productivity, revenue, and entrance/exit, by taking into consideration technology relocation through FDI. The study concluded that if thehost country’s’ government providedhigher tax relief to foreign companies, this will result in rise in total yield and decrease price index which will encourage more foreign businesses to move in the industry while certain present host businesses will need to departure. Research also suggested that government should be cautious in decreasing rate of taxes to attract FDI.
Vita and Kyaw (2008) used empirically controllable structural VAR model for identifyingdetermining factors of investment flows and variance decomposition and impulse response analyses to examine the time-based dynamic effects of variations in both pull andpushmotivators on FDI and portfolio investments. Study suggested that variation in real variables representing economic activity for example domestic productivity and foreign output possess more power in explaining variability in investment flows to developing nations. This research developed structural VAR model to test relative importance of the determinants of disaggregated investment flows to developing countries. The study investigated the degree to which deviations in FDI and portfolio investmentswere caused by variety of pull andpush factors throughvariousperiod horizons.
Studying the impact of FDI on variousfacets of local economies, containingglobal trade, employment, gross fixed capital formation, output, balance of payments(BoP) and overall welfareHejazi and Pauly (2003) found that FDI was encouraged by market access and factor price differences, and on the role of intra-firm trade. According to the research prediction of whether growth in outward FDI will increase or decrease domestic GFCF is not possible. Therefore, comparisons of such growth relative to growth in inward FDI can be a misleading indicator for policy makers. Since the impact of FDI on domestic GFCF depends on the underlying motivation for investment, and not simply on the growth in outward relative to inward FDI, the results are of interest to all countries. The implication of results stated that quickprogress in outward foreign direct investment, comparative to inward progress, should not be taken as a negative growth, butmightbe source of success.
Chen (1996) suggested that capacity of the market share to expand affected inward flow ofFDI but labor cost (WAGE) does not affect FDI. Similarly foreign investing companies had utilized the natural and energy resources of Western regiondespite of low allocative efficiency in this area.Interregionalrailwaynetworksweresignificant in location preference of foreign investors’. Besides that, foreign investors were reluctant in locating near state-of-the-artlocal Chinese businesses in the eastern as well as middle provinces. These results were significant because the choice of FDI location appeared to have been motivated by the presence of good transportconnections, high-tech filtering and, to some level by the capacity of the market share to expand. The choice of FDI location did not appear to have been persuaded by taking into accountlabor cost variances.
According to the neoclassical model of growth, growth rate of labor as well as technological developmentwere considered as exogenous and inward Foreign Direct Investment (FDI) will lead to increase in the investment rate and which will ultimately lead to increase in the growth of per capita income but the growth effect will not last in the long run (Hsiao and Hsiao, 2006). Papanek (1973) indicatedstatistically significant negative effect of varioussorts of investment on domestic savings. Grounded on a sample of 85emerging countries, researchconcluded that foreign investment displaced national savings. Precisely, the research exhibited all types of foreign investment either in shape of aid or individual investment compressed the domestic savings. As a result the economy of the FDI recipient country went into state ofhigher dependency on foreign investment for development.
The empirical studies of Cushman (1985) based U.S. bilateral FDI outflow and inflow data concluded that exchange rate variability had positive relation with set of flows.Connor (1983) conducted research which focused on inward as well as outward flow of FDI. The study divided country specific advantages into three categories FDI Probability, FDI Propensity and FDI Penetration and their impact on FDI.Larudeeand Koechlin (1999) research focused on the wages or labor costs and productivity in terms of production costs as the determinants of FDI. This research used”sweatshop labor argument” that relied indirectly on assumption of simplistic trade model that assumed all of the national firms to have access to similar technology. But in contrary MNE and abundant theory acquire higher labor efficiency due to the firm related advantages MNE possess. Thediscrepancy between investing and recipient country in average manufacturing wage should therefore be an independent determinant of FDI flows.
CHAPTER 3:
PROPOSED METHODOLOGY
3.1 Method of Data Collection
The secondary data necessarily required to perform the research was gathered from the official sites of The World Bank and The State Bank of Pakistan. Additionally, some of the required data was abstracted from the book Statistical Supplement and Yearly Book both being published under the supervision of State Bank of Pakistan.
3.2 Sample Size
The data used for the purpose of research consisted of 30 years annual data of the variables used in research. Data of all the variables belonged to period starting from fiscal year 1980 to fiscal year 2010.
3.4 Research Model developed
In order to test the hypothesis of the research multiple regression model was developed. The model established is similar to the research model used by Kyrkilis and Pantelidis (2003).
FDI= α + β0GDP + β1GDPG – β2Wage- β3I + β4ER + β5IE – β6T – β7IR + µ
Where
FDI = Net amount of Foreign Direct Investment received by Pakistan
Wage = Annual wages paid to a worker (Labor cost)
I = Inflation,IR = Interest rate, ER = Exchange rate, IE = Infrastructure expenditure,T = Taxes, GDP = Gross domestic product,GDPG = GDP per capita growth rate.
3.3 Statistical Technique
In order to test the hypothesis developed of the research the statistical technique of multiple regressionanalysis was applied. This technique was applied because both the dependent variable and independent variables were scale and under this situation the prediction power of regression analysis is stronger as compared with the other statistical techniques available.
CHAPTER 4:
RESULTS
4.1 Findings and Interpretation of the results
The results drawn by applying Multiple Regression analysis were as follows:
Table: 4.1 Model Summary
Model
R
R Square
Adjusted R Square
Std.Errorof the Estimate
Durbin-Watson
1
.998a
.996
.995
6.65146E17
2.744
The model summary table explains what amount of variance in the dependent variable is explained by the independent variables. The value of R-square is .996 which means that approximately 99.6 % of the variance of SQFDI is accounted for by the model and only .04 % of the variance remains unexplained. Independent variables were square of Infrastructure Expenditure (PSDP Fund), Interest Rate (IR), Inflation (I) and Exchange Rate (ER) and the dependent variablewas Square of Net Foreign Direct Investment (SQFDI).
Table: 4.2 ANOVA
Model
Sum of Squares
df
Mean Square
F
Sig.
1
Regression
2.524E39
4
6.310E38
1426.142
.000a
Residual
1.106E37
25
4.424E35
Total
2.535E39
29
The Anova table explains the model fit, sig. value of .000 suggests F-test to be significant, and therefore the model is statistically significant. When the sig. value in the Anova table is less than .05 the model fit is good and regression can be applied on the data.
Table: 4.3 Coefficients
Model
Unstandardized Coefficients
Standardized Coefficients
t
Sig.
Collinearity Statistics
B
Std. Error
Beta
Tolerance
VIF
1
(Constant)
-9.595E17
7.703E17
-1.246
.224
Inflation
-8.806E16
3.960E16
-.037
-2.224
.035
.640
1.562
Interest Rate
2.047E17
6.261E16
.045
3.270
.003
.920
1.086
Exchange rate
-5.646E16
9.021E15
-.125
-6.259
.000
.440
2.273
IE
1.654E8
3349513.619
1.094
49.392
.000
.356
2.809
The co-efficients table shows the significance of individual independent variable in explaining the dependent variable. In the final model square of Infrastructure Expenditure (PSDP Fund), Interest Rate (IR), Inflation (I) and Exchange Rate (ER) were the statistically significant variables.The effect of Inflation (Standardized B= -.037, P =.035) is statistically significant havingnegative coefficientdemonstrating that largerthe value of inflation rate, the lower the Foreign Direct Investment. The value of beta indicates that 1 unit increase in inflation will decrease FDI by .037units. Similarly, the effect of Interest Rate (Standardized B= .045, P =.003) is significant and its coefficient is positive indicating that the greater the value of interest rate, the higher the amount of FDI received. The value of beta indicates that 1 unit increase in interest rate will increase FDI by .045units. Next, the effect of Exchange Rate (Standardized B= -.125, P =.000) is statistically significant havingnegative coefficientdemonstrating that larger the value of exchange rate, the lower the amount of FDI. The value of beta indicates that 1 unit increase in exchange rate will decrease FDI by .125units. Finally, the effect of Infrastructure Expenditure (Standardized B= 1.094, P =.000) is also statisticallysignificant having positive coefficient indicating that the greater the amount spent by government as infrastructure expenditure, the higher the amount of FDIreceived. The value of beta indicates that 1 unit increase in amount of infrastructure expenditure will lead to an increase of 1.094 units in FDI.
Empirical Model Developed
FDI = 1.094 InfrastructureExpenditure + .045 Interest Rate – .125 Exchange Rate
– .037 Inflation
4.2 Hypothesis Assessment Summary
Hypothesis
β
Sig.
E.C
H1: GDP has positive impact on FDI
.089
.560
Reject
H2: Infrastructure expenditure has positive impact on FDI
1.094
.000
Accept
H3: Taxes has negative impact on FDI
Reject
Aggregate Selection for Concrete
H4: Inflation has negative impact on FDI
-.037
.035
Accept
H5:GDP per capita growth has positive impact on FDI
ABSTRACT
Globally issues of environment and climate change are major problems. In 21st Century construction industry is at its peak (including dismantling concrete structures). It is the only time when governments, businesses and consumers have to rethink about traditional practices, products and policies in this direction. Now a day sustainable development is in demand. Sustainable development I is possible by revising, rethinking, reducing, reuse. In construction scope of reuse of material is so vast. The use of waste materials (glass, plastic, slag, fly ash and so on) in concrete industrial is major due to its engineering, economic, eco-friendly and green paybacks. Thus, consumption of waste materials in concrete construction is very much useful to obtain the objective of the sustainability. This study is based on the performance of three different concrete mixes having different ratios of crushed, waste tiles having 20 mm maximum size as coarse aggregate. Coarse sand, ordinary Portland Cement 53 grade were used for standard concrete cubes. Test results shows that except Mix 30 mix there is no major effect on compressive strength of concrete in Mix 20 and Mix 25 mixes up to 20% replacement of normal 20 mm coarse aggregates with tile aggregates. But beyond that, strength started declining slowly with rising the amount of tile aggregates in concrete.
CHAPTER- 1
Introduction
1.1 GENERAL
In this era concrete production is at peak and large amount of cementitious material, natural aggregates (fine and course) and water are being used. Aggregates impart about 70% to 75% of volume to concrete. In parallel to this many research works are under progress to find suitable alternatives of raw materials of concrete. Utilization of waste materials for example fly ash, plastic waste, construction waste are most common research areas. Tile waste is also a best sustainable alternative for course aggregates in concrete. Construction industry is producing huge amount of tile waste worldwide in small, medium and large projects. This broken tile wastes are deposited into environment as liability without any profitable return. Plenty of money is being spent for its deposition and even land become useless in most of the cases.
So it is better to reuse this waste material in concrete as supplementary. Ceramic tile aggregates are hard having significant value of specific gravity, rough surface on one side and smooth on other side, are lighter in weight than normal aggregates. Consuming ceramic tile aggregate in concrete not only will be cost effective, but also will be good from environment point of view.
This study focuses on preparing concrete of acceptable strength with crushed waste ceramic tile as aggregates (course) and finding the optimum course aggregate mix ratio to get this strength.
1.2 OBJECTIVE
Concrete consumption is two times more than any other building material around the world. So it is important to find sustainable alternatives of its raw materials. Because over consumption of traditional natural raw material is misbalancing environment.
Main objectives of this study are:
- To find alternative of traditional course aggregates in order to achieve sustainable progress.
- To minimize the construction waste
- To develop more economical concrete material.
1.3 MATERIAL SOURCE
- Tile industry- India is 3rd largest tile production country
- Construction Projects- Nearly 10% of tiles are waste in large construction projects which can be used as course aggregates
- Tile distributers- Large amount of tiles get broken during transportation in wholesale that is also contribution in overall construction waste and can be reuse.

FIGURE 1.1 CERAMIC TILE AGGREGATES
1.4 SCOPE OF INVESTIGATION
As per IS 383:1770 flaky shape material is not permitted in concrete mix. Even other general specifications are not permitting to use low quality materials in construction. Tile waste is a flaky material but it is passing other quality criteria. To overcome problem of flakiness this waste material can be used as partial replacement.
Even in IS 456:2000 fly ash, slag type waste material is permitted to use without compromising the quality of the work. Along with these waste materials waste from steel industry, crushed over-burnt bricks and tiles – waste from clay brick and tile industry, in plain cement concrete as an alternative to sand/natural aggregate, subject to fulfilling the requirements of the Code.
Many experimental studies concerning tile aggregates can be helpful for this initiative of BIS to promote the suitable tile waste usage in concrete and made a provision in concrete code and national building codes of nation.
To encourage the use of tile aggregates in the Indian construction sector, it is required to make these specifications more liberal otherwise the use of tile aggregates in stable works other than reclamation and earth filling is almost difficult.
1.5 METHODOLOGY
M 20, M 25 & M 30, three different concrete mix design chosen to carry out the investigate the effect of tile waste as partial aggregate replacement.
Below mentioned preparation will be made to caste samples
Table 1.1 Specimen Details
| Total number of concrete mix designs will be prepared | 3 |
| Number of proportions in which tile aggregates will be replaced with normal aggregates in each design (i.e. 0%, 5%, 10% & 20%) | 4 |
| Therefore, total concrete batches will be prepared | 12 |
| Number of concrete batches will be prepared in a day | 1 |
| Number of cubes will be filled in each batch | 6 |
| Number of cubes will be casted for each mix design
For M 20 – 24 cubes For M 25 – 24 cubes For M 30 – 24 cubes |
24 |
| Total number of cubes will be casted including all 3 concrete mix designs | 24+24+24=72 |
| Size of Specimen | 150×150×150 mm cube |
| Name of Test | Compression Strength Test |
CHAPTER – 2
Literature Review
2.1 REVIEW
Kumar (2015)
In this study, different mixes are adopted, waste tiles are used to replace the coarse aggregate by 10% and 20% and tiles powder are also used to replace the fine aggregates by 10% and 20%. Total 9 types of mixes of M25 grade are adopted. A study on workability and compressive strength for 7 and 28 days of all 9 types of mixes has been succeed and recorded that with rise the percentage of tiles powder the strength and workability also increased of concrete. Compressive strength is increased for all mixes and maximum compressive strength is obtained the mix having 10% of crushed tiles and 20% of tiles powder. The best percentage of coarse aggregate that can be replaced by crushed tiles with 10%.
Alves (2014)
In this study reused ceramic fine aggregates, obtain00ed from crushed sanitary and crushed bricks ware on the mechanical properties such as compressive, modulus of elasticity, splitting tensile strength, and abrasion resistance of concrete. Seven concrete mixes were used to test these tough properties and six concrete mixes with replacement ratios of the 20%, 50% and 100% of natural fine aggregates by fine recycled brick aggregates or fine recycled sanitary ware aggregates. Compressive and splitting tensile strength do not appear to be affected by fine brick aggregates and these properties significantly reduced with the fusion of recycled fine sanitary ware aggregates.
Medina (2012)
Medina deliberate on consumption of ceramic waste as recycled coarse aggregate. Crushed sanitary ware was used in it and its shape curve of recycled ceramic aggregate was similar to the natural coarse aggregate. Uneven shape of aggregate was offered in the ceramic waste, resulted that superior surface area and improved bonding was observed in investigation.
Sekar (2011)
In this study different industrial waste such as glass waste aggregates, ceramic tile waste aggregates, ceramic insulator waste aggregate with 100% replacement was studied. It was found that the concrete made with ceramic tile waste gives similar strength (split tensile, Compression, flexural) as conventional concrete. On the other hand, concrete with ceramic insulator and glass waste give lesser strength than traditional concrete.
Pacheco (2010)
In this study it was concluded that concrete with ceramic waste residue has a minor strength loss have risen durability production because of its pozzolanic belongings. As for replacement of coarse aggregate with ceramic coarse aggregate, the outcomes are better but underachieved somewhat in water absorption and in the water permeability meaning that the replacement of sand by the ceramic sand is a superior choice.
Veera Reddy (2010)
Veera Reddy reported on impact value and crushing value of ceramic scrap as 18.2 and 24.7% respectively. These values were within the permissible limits according to IS 383-1970, hence it was safe to use as a coarse aggregate in concrete composition.
Paulo Cachim (2009)
Paulo Cachim studied on usage of ceramic aggregate, collected from ceramic industrial waste. Water absorption of waste from two different sources was 15.81 and 18.91% respectively. The higher water absorption of ceramic aggregates influenced the workability of concrete. It was observed that in first 2 minutes, 75% of total absorption observed and after 5 min at least 91% of total absorption occurred.
Mashitah (2008)
In this study it was concluded on recycling of similar ceramic tiles used in the preparation of concrete cubes. The surface of ceramic tile aggregate was found as angular shaped and smooth, sharpen edges as compared with traditional coarse aggregate. Flatter particles consumed extra amount of cement paste to make better inter facial transition zone.
Senthamarai (2005)
Senthamarai observed that ceramic tile scrap can be successfully used as aggregates in concrete production, on the basis of strength of ceramic waste aggregate. The abrasion values, crushing value, impact value for ceramic scrap were 28, 21 and 21% correspondingly and for natural coarse aggregate 20, 17 and 24% respectively. Ceramic waste does not have much difference with respect to the traditional natural aggregates.
Marcio (2004)
Marcio experimented on compressed stress, water absorption and modulus of elasticity of concrete made with ceramic aggregate. Crushed ceramic blocks were used as coarse aggregate in concrete fabrication. Specific density of aggregate was 2630 to 2310 kg/m3 for 0 to 100% replacement. Up to the replacement of 20%, Compression resistance and modulus of elasticity was equivalent with conventional concrete.
Chapter – 3
Aggregate Selection for Concrete
3.1 THE ROLE OF THE AGGREGATE IN CONCRETE
The protection of the environment concerns three basic things:
- Raw material (aggregates for the production of concrete) which result in the reduction of existing natural resources which is endlessly sub-graded.
- For the production and transportation of aggregates high amounts of energy has to be consumed
- Waste due to demolition.
The cementing material has two core functions –
- To impart strength to hardened concrete.
- To fill voids between aggregate particles providing lubrication of the fresh (plastic) concrete and water tightness.
The aggregate in concrete has three main purposes –
- To provide a bulk of particles which are fit for resisting the stroke of applied loads, abrasion the filtration of moisture weathering affects.
- To provide a comparatively economical filler for the cementing material.
- To minimize the volume changes resulting from the setting and hardening development and from moisture variation in the cement paste.
In concrete there are 70 to 80 % aggregate and exert an influence on concrete properties. They are granular material from natural rock, gravels. However, one of the fact that has made concrete, the world’s most widely used construction material is its ability to absorb a wide range of quality of materials, including recycled and industrial by products, as a component of the aggregate. In selecting aggregate for use in concrete certain constituents should be avoided. For example, reactive silica leads to deterioration of concrete if moisture and alkali are present; weak friable aggregate should not be used if hardness is desired concrete property; and a highly porous aggregate is potentially unsuitable with respect to aggressive permeation – based deterioration processes. Some of these properties are directly dependent upon the parent rock whilst others are not. For example, those dependent on parent rock are chemical and mineralogical descriptions, petro graphic description, specific gravity, strength, hardness, and color, while surface texture, size and shape are independent of parent rock. The simplest and most common method for characterization of aggregate is on the basis of the specific gravity, i. e.
(i) Normal weight
(ii) Light weight and
(iii) Heavy weight.
Further characterization may be achieved using the following: grading, shape, inclusion, bulk density, water absorption, chemical composition and drying shrinkage.
3.2 SELECTION OF AGGREGATES
Aggregates directly affect the properties of concrete. In plastic stage, water requirement, cohesiveness and workability of the concrete, in hardened stage they effect density, strength, durability, surface finish permeability, and colour. Aggregates are generally classified into two categories viz. natural and manufactured/processed.
- FACTORS INFLUENCING CONCRETE
Chemical Stability
Specific gravity
Shape
Maximum size
Gradation / Particle size distribution
Surface texture
CHAPTER – 4
Material and Concrete Mix- Design
4.1 SIEVE ANALYSIS –
COARSE AGGREGATES
Crushed Tile Aggregates
Test – 1
Total weight of sample = 3980 g
TABLE 4.1 – SIEVE ANALYSIS (CRISHED TILE AGGREGATES)
| IS sieve
sizes (mm) |
Weight Retained
(grams) |
Weight Retained % | Accumulative
% |
Passing
% |
Limits Required |
| 40 | 0 | 0 | 0 | 100 | 100 |
| 20 | 10 | 0.25 | 0.25 | 99.75 | 95-100 |
| 10 | 2935 | 73.74 | 73.99 | 26.01 | 25-55 |
| 4.75 | 960 | 24.12 | 98.11 | 1.89 | 0-10 |
| Pan | 90 | ||||
Result – Tile aggregates satisfy the rage of 20mm nominal size aggregates as per IS:383-1970.
Normal Aggregates
Test – 2
For 20 mm Aggregates
Total weight of sample – 3480 g
TABLE 4.2 – SIEVE ANALYSIS (NORMAL 20mm AGGREGATES)
| IS sieve
sizes (mm) |
Weight Retained
(grams) |
Weight Retained % | Accumulative
% |
Passing
% |
Limits Required |
| 40 | 0 | 0 | 0 | 100 | 100 |
| 20 | 305 | 8.76 | 8.76 | 91.24 | 85-100 |
| 10 | 3165 | 90.94 | 99.70 | 0.3 | 0-20 |
| 4.75 | 10 | 0.28 | 99.98 | 0.02 | 0-5 |
Result – Satisfy the range of 20 mm nominal size aggregates as per IS: 383-1970.
Test – 3
For 10 mm Aggregates
Total weight of sample – 2100 g
TABLE 4.3 – SIEVE ANALYSIS (NORMAL 10mm AGGREGATES)
| IS sieve
sizes (mm) |
Weight Retained
(grams) |
Weight Retained % | Accumulative
% |
Passing
% |
Limits Required |
| 12.5 | 0 | 0 | 0 | 100 | 100 |
| 10 | 305 | 14.52 | 14.52 | 85.48 | 85-100 |
| 4.75 | 1760 | 83.80 | 98.32 | 1.67 | 0-20 |
| Pan | 35 | ||||
Result – Satisfy the 10 mm nominal size aggregates as per IS: 383 – 1970.
Test – 4
Total weight of sample – 3000 g
Proportion of 20 mm aggregates – 40% = 1200 g
Proportion of 10mm aggregates – 60% = 1800 g
TABLE 4.4 – SIEVE ANALYSIS (40-60 PROPORTION AGGREGATES)
| IS sieve
sizes (mm) |
Weight Retained
(grams) |
Weight Retained % | Accumulative
% |
Passing
% |
Limits Required |
| 40 | 0 | 0 | 0 | 100 | 100 |
| 20 | 130 | 4.33 | 4.33 | 95.67 | 95-100 |
| 10 | 2250 | 75 | 79.33 | 20.67 | 22-55 |
| 4.75 | 605 | 20.16 | 99.49 | 0.59 | 0-10 |
| Pan | 0.59 |
Result – Sample is in limits as per IS: 383 – 1970
FINE AGGREGATES
Test – 1
Total weight of sample – 2300 g
TABLE 4.5 – SIEVE ANALYSIS (FINE AGGREGATES)
| IS sieves
sizes (mm) |
Weight Retained
(grams) |
Weight Retained % | Accumulative
% |
Passing
% |
Limits Required |
| 10 | 0 | 0 | 0 | 100 | 100 |
| 4.75 | 50 | 2.17 | 2.17 | 97.83 | 90-100 |
| 2.36 | 140 | 6.08 | 8.25 | 91.75 | 75-100 |
| 1.18 | 480 | 20.86 | 29.11 | 70.89 | 55-90 |
| 300µ | 1195 | 51.95 | 81.06 | 18.94 | 8-30 |
| 150µ | 360 | 15.65 | 96.31 | 3.29 | 0-10 |
| Pan | 70 |
Result – This sample satisfy the fine aggregate limits of Grading Zone 2 as per IS: 383-1970.
Fineness Modulus = Total of all Accumulative % / 100 = 2.173 %
TABLE 4.6 – TEST RESULT
| Sr. No. | Test | Results |
| 1 | Specific Gravity Of Cement | 2.74 |
| 2 | Specific gravity of Coarse Aggregates | 2.69 |
| 3 | Specific gravity of Fine Aggregates | 2.70 |
| 4 | Fineness Modulus of Fine Aggregates | 2.17 |
| 5 | Specific Gravity of Tile Aggregates | 2.24 |
| 6 | Water Absorption of Tile Aggregates | 14.4% |
| 7 | Impact Value of Tile Aggregates | 20% |
TABLE 4.7 – COMPARISON (PROPERTIES OF TILE AGGREGATES AND NORMAL AGGREGATES)
| Sr. No. | Properties | Normal aggregate | Tile aggregate |
| 1 | Shape | Angular | Flaky |
| 2 | Texture | Rough | All sides rough except top |
| 3 | Water absorption | 0.5% | 14.4% |
| 4 | Impact value | 15% | 20% |
| 5 | Specific gravity | 2.69 | 2.24 |
4.2 COMPRESSION TEST SPECIMENS (MAKING AND CURING)
PREPRATION OF MATERIALS
27° ± 3°C temperature is preferable for all material in concrete. After thorough mixing of cement by machine or manual, it should be stored in air tight container in laboratory.
Sample of aggregate should be in air dried conditions
MIXING CONCRETE
Mixing of concrete should be mixed in machine. Batch of concrete shall be of such a size as to extra about 10 percent after molding the chosen number of test specimens.
WORKABILITY
According to IS : 1199-1959 consistency of each batch of concrete immediately after mixing. Care should be taken that there is no water loss during the test
SIZE OF TEST SPECIMENS
Cube Moulds
The mould shall be of 150 mm size conforming to IS : 10086-1982.

FIGURE 4.1 CUBE MOULDS
Tamping Bar — The tamping bar shall conform to 6.1(a) of IS: 10086-1982*.
COMPACTING
Each specimen need proper compaction. Care should be taken that there is no chance of bleeding and segregation. Filling of concrete in cube mould should be in layers by compacting each layer properly.
Compaction by Vibration – After filling the mould, each specimen shall be vibrated by means of an electric or pneumatic hammer or vibrator or by means of a suitable vibrating table until the specified condition is attained.

FIGURE 4.2 – COMPACTION BY VIBRATOR
CURING
Proper curing is very much important for concrete. It directly influenced hard properties of concrete. 22° to 32°C temperature is most suitable for storage of water. Water that is suitable for drinking is satisfactory for use in concrete (mixing and curing)
4.3 TEST FOR COMPRESSIVE STRENGTH OF CONCRETE SPECIMEN
After taken out form the curing tank at the age of 28 days cube specimens of size 150mm x 150mm x 150mm tested exactly after remove from the water . Surface was free from water, the specimen were tested. The position of the cube is right angle when tested.
The compressive strength is obtained by the formula as given below.
Compressive strength of specimen=Load at which specimen fail/Cross sectional area of specimen

FIGURE 4.3 COMPRESSION TESTING MACHINE
4.4 CONCRETE MIX DESIGN
MIX PROPORTIONING FOR M 20 GRADE CONCRETE
STIPULATIONS FOR PROPORTIONING
- Grade Designation – M 20
- Type of Cement – OPC 53 Grade
- Admixture (if added) – Nil
- Maximum nominal size of aggregates – 20 mm
- Minimum cement content – 300 kg/m3
- Maximum water – cement ratio – 0.55
- Workability – 25 to 50 mm (slump)
- Exposure condition – Mild
- Degree of supervision – Good
TEST DATA FOR MATERIALS
- Cement used – OPC 53 Grade
- Initial setting time – 60 minutes
- Final time – 4 hours
- Consistency – 37%
- Specific gravity of cement – 2.74
- Chemical admixture – Nil
- Specific gravity of:
- Coarse aggregates – 2.69
- Fine aggregates – 2.70
- Water absorption:
- Coarse aggregates – 0.5%
- Fine aggregates – 1%
- Sieve analysis:
- Coarse aggregates – Confirming to
Table 2 of IS 383
- Fine aggregates – Confirming to grading
Zone 2 of Table 4 of IS 383
TARGET STRENGTH
fʹck = fck + 1.65 S
f′ck – Target Mean Strength
fck – Characteristics Strength
S – Standard Deviation
f′ck = 20+1.65 (4) = 26.6
S = 4 (assumed from Table 1 IS 10262: 2009)
SELECTION OF WATER – CEMENT RATIO
Water Cement Ratio – 0.55 (maximum)
Adopted water – cement ratio = 0.55
Minimum Cement Content – 300 kg/m3
From Table 5 IS 456:2000 for mild exposure.
- Water Content – 186 kg (maximum)
From Table 2 IS 10262:2009 for 20mm aggregates.
(For slump range 25mm to 50mm)
- Calculation of Cement Content –
Cement content = 186/0.55 = 338.18 kg/m3
Here 0.55 is water cement ratio
338.18>300 kg/m3,
Hence OK.
- Volume of Coarse Aggregates per unit volume of total aggregates for different zones of Fine Aggregates – 0.62
(For 20 mm nominal maximum size of aggregates from Table 3 Zone 2 IS 10262:2009)
- Volume of Fine Aggregates in total = 1 – 0.62 = 0.38
Mix proportion for M 20 (with 0% tile aggregates)
Cement – 338.18 kg
Water – 186 kg
Fine aggregates – 708.96 kg
Coarse aggregates – 1152.44 kg
Water cement ratio – 0.55
RATIO
| Cement | Fine Aggregates | Coarse Aggregates | Water cement
Ratio |
| 1 | 2.09 | 3.40 | 0.55 |
Mix proportion for M 20
(5% replacement of normal aggregates with tile aggregates)
Coarse aggregates – 1152.44 kg
(i.e. Total, including 20 mm & 10 mm aggregates)
Now,
Volume of 10 mm aggregates taken in concrete = 60%
Volume of 20 mm aggregates taken in concrete = 40%
40% of 1152.44 = 460.97 kg (20 mm aggregates)
5% of 460.97 = 23.048 kg (Tile aggregates)
Therefore,
- Cement – 338.18 kg
- Water – 186 kg
- Fine aggregates – 708.96 kg
- Coarse aggregates –
- Tile aggregates = 23.048 kg
- 10 mm aggregates = 691.47 kg
- 20 mm aggregates = 460.97 – 23.048
= 437.92 kg
Mix proportion for M 20
(10% replacement of normal aggregates with tile aggregates)
Coarse aggregates – 1152.44 kg
(i.e. Total, including 20 mm & 10 mm aggregates)
Now,
Volume of 10 mm aggregates taken in concrete = 60%
Volume of 20 mm aggregates taken in concrete = 40%
40% of 1152.44 = 460.97 kg (20 mm aggregates)
10% of 460.97 = 46.09 kg (Tile aggregates)
Therefore,
- Cement – 338.18 kg
- Water – 186 kg
- Fine aggregates – 708.96 kg
- Coarse aggregates –
- Tile aggregates = 46.09 kg
- 10 mm aggregates = 691.47 kg
- 20 mm aggregates = 460.97 – 46.09
= 414.88 kg
Mix proportion for M 20
(20% replacement of normal aggregates with tile aggregates)
Coarse aggregates – 1152.44 kg
(i.e. Total, including 20 mm & 10 mm aggregates)
Now,
Volume of 10 mm aggregates taken in concrete = 60%
Volume of 20 mm aggregates taken in concrete = 40%
40% of 1152.44 = 460.97 kg (20 mm aggregates)
20% of 460.97 = 92.19 kg (Tile aggregates)
Therefore,
- Cement – 338.18 kg
- Water – 186 kg
- Fine aggregates – 708.96 kg
- Coarse aggregates –
- Tile aggregates = 92.19 kg
- 10 mm aggregates = 691.47 kg
- 20 mm aggregates = 460.97 – 92.19
= 368.78 kg
MIX PROPORTIONING FOR M 25 GRADE CONCRETE
STIPULATIONS FOR PROPORTIONING
- Grade Designation – M 25
- Type of Cement – OPC 53 Grade
- Admixture (if added) – Nil
- Maximum nominal size of aggregates – 20 mm
- Minimum cement content – 300 kg/m3
- Maximum water – cement ratio – 0.50
- Workability – 25 to 50 mm (slump)
- Exposure condition – Moderate
- Degree of supervision – Good
TEST DATA FOR MATERIALS
- Cement used – OPC 53 Grade
- Initial setting time – 60 minutes
- Final setting time – 4 hours
- Consistency – 37 %
- Specific gravity of cement – 2.74
- Chemical admixture – Nil
- Specific gravity of:
- Coarse aggregates – 2.69
- Fine aggregates – 2.70
- Water absorption:
- Coarse aggregates – 0.5%
- Fine aggregates – 1%
- Sieve analysis:
- Coarse aggregates – Confirming to
Table 2 of IS 383
- Fine aggregates – Confirming to grading
Zone 2 of Table 4 of IS 383
TARGET STRENGTH
fʹck = fck + 1.65 S
f′ck – Target Mean Strength
fck – Characteristics Strength
S – Standard Deviation
f′ck = 25+1.65 (4) = 31.6
S = 4 (assumed from Table 1 IS 10262: 2009)
SELECTION OF WATER CEMENT RATIO
Water Cement Ratio – 0.50 (maximum)
Adopter water – cement ratio = 0.50
Minimum Cement Content – 300 kg/m3
From Table 5 IS 456:2000 for mild exposure.
Water Content – 186 kg (maximum)
From Table 2 IS 10262:2009 for 20mm aggregates.
(For slump range 25mm to 50mm)
Calculation of Cement Content –
Cement content = 186/0.50 = 372 kg/m3
Here 0.50 is water cement ratio
372 > 300 kg/m3, hence OK.
Volume of Coarse Aggregates per unit volume of total aggregates for different zones of Fine Aggregates – 0.62
For 20 mm nominal maximum size of aggregates from Table 3 Zone 2 IS 10262:2009
Volume of Fine Aggregates in total = 1 – 0.62 = 0.38
Mix proportions for M 25
Cement – 372 kg
Water – 186 kg
Fine aggregates – 696.65 kg
Coarse aggregates – 1132.43 kg
Water cement ratio – 0.50
RATIO
| Cement | Fine Aggregates | Coarse Aggregates | Water |
| 1 | 1.87 | 3.04 | 0.50 |
Mix proportion for M 25
(5% replacement of normal aggregates with tile aggregates)
Coarse aggregates – 1132.43 kg
(i.e. Total, including 20 mm & 10 mm aggregates)
Now,
Volume of 10 mm aggregates taken in concrete = 60%
Volume of 20 mm aggregates taken in concrete = 40%
40% of 1132.43 = 452.97 kg (20 mm aggregates)
5% of 452.97 = 22.64 kg (Tile aggregates)
Therefore,
- Cement – 372 kg
- Water – 186 kg
- Fine aggregates – 708.96 kg
- Coarse aggregates –
- Tile aggregates = 22.64 kg
- 10 mm aggregates = 679.46kg
- 20 mm aggregates = 452.97 – 22.64
= 430.33 kg
Mix proportion for M 25
(10% replacement of normal aggregates with tile aggregates)
Coarse aggregates – 1132.43 kg
(i.e. Total, including 20 mm & 10 mm aggregates)
Now,
Volume of 10 mm aggregates taken in concrete = 60%
Volume of 20 mm aggregates taken in concrete = 40%
40% of 1132.43 = 452.97 kg (20 mm aggregates)
10% of 452.97 = 45.29 kg (Tile aggregates)
Therefore,
- Cement – 372 kg
- Water – 186 kg
- Fine aggregates – 708.96 kg
- Coarse aggregates –
- Tile aggregates = 45.29 kg
- 10 mm aggregates = 696.65 kg
- 20 mm aggregates = 452.97 – 45.29
= 407.68 kg
Mix proportion for M 25
(20% replacement of normal aggregates with tile aggregates)
Coarse aggregates – 1132.43 kg
(i.e. Total, including 20 mm & 10 mm aggregates)
Now,
Volume of 10 mm aggregates taken in concrete = 60%
Volume of 20 mm aggregates taken in concrete = 40%
40% of 1132.43 = 452.97 kg (20 mm aggregates)
20% of 452.97 = 90.59 kg (Tile aggregates)
Therefore,
- Cement – 372 kg
- Water – 186 kg
- Fine aggregates – 708.96 kg
- Coarse aggregates –
- Tile aggregates = 90.59 kg
- 10 mm aggregates = 696.65 kg
- 20 mm aggregates = 452.97 – 90.59
= 362.38 kg
MIX PROPORTIONING FOR M 30 GRADE CONCRETE
STIPULATIONS FOR PROPORTIONING
- Grade Designation – M 30
- Type of Cement – OPC 53 Grade
- Initial setting time – 60 minutes
- Final setting time – 4 hours
- Consistency – 37%
- Admixture (if added) – Nil
- Maximum nominal size of aggregates – 20 mm
- Minimum cement content – 320 kg/m3
- Maximum water – cement ratio – 0.45
- Workability – 25 to 50 mm (slump)
- Exposure condition – Severe
- Degree of supervision – Good
TEST DATA FOR MATERIALS
- Cement used – OPC 53 Grade
- Specific gravity of cement – 2.74
- Chemical admixture – Nil
- Specific gravity of:
- Coarse aggregates – 2.69
- Fine aggregates – 2.70
- Water absorption:
- Coarse aggregates – 0.5%
- Fine aggregates – 1%
- Sieve analysis:
- Coarse aggregates – Confirming to
Table 2 of IS 383
- Fine aggregates – Confirming to grading
Zone 2 of Table 4 of IS 383
TARGET STRENGTH
fʹck = fck + 1.65 S
f′ck – Target Mean Strength
fck – Characteristics Strength
S – Standard Deviation
f′ck = 30+1.65 (5) = 38.25
S = 4 (assumed from Table 1 IS 10262: 2009)
Water Cement Ratio – 0.45 (maximum)
Adopted water – cement ratio = 0.45
Minimum Cement Content – 320 kg/m3
From Table 5 IS 456:2000 for mild exposure.
Water Content – 186 kg (maximum)
From Table 2 IS 10262:2009 for 20mm aggregates.
(For slump range 25mm to 50mm)
Calculation of Cement Content –
Cement content = 186/0.45 = 413.33 kg/m3
Here 0.45 is water cement ratio
413.33 > 320 kg/m3, hence OK.
Volume of Coarse Aggregates per unit volume of total aggregates for different zones of Fine Aggregates – 0.62
For 20 mm nominal maximum size of aggregates from Table 3 Zone 2 IS 10262:2009
Volume of Fine Aggregates in total = 1 – 0.62 = 0.38
Mix proportions for M 30
Cement – 413.33 kg
Water – 186 kg
Fine aggregates – 681.26 kg
Coarse aggregates – 1107.41 kg
Water cement ratio – 0.45
RATIO
| Cement | Fine Aggregates | Coarse Aggregates | Water |
| 1 | 1.64 | 2.67 | 0.45 |
Mix proportion for M 30
(5% replacement of normal aggregates with tile aggregates)
Coarse aggregates – 1107.41 kg
(i.e. Total, including 20 mm & 10 mm aggregates)
Now,
Volume of 10 mm aggregates taken in concrete = 60%
Volume of 20 mm aggregates taken in concrete = 40%
40% of 1107.41 = 442.96 kg (20 mm aggregates)
5% of 442.96 = 22.14 kg (Tile aggregates)
Therefore,
- Cement – 413.33 kg
- Water – 186 kg
- Fine aggregates – 681.26 kg
- Coarse aggregates –
- Tile aggregates = 22.14 kg
- 10 mm aggregates = 664.45 kg
- 20 mm aggregates = 442.96 – 22.14
= 420.82 kg
Mix proportion for M 30
(10% replacement of normal aggregates with tile aggregates)
Coarse aggregates – 1107.41 kg
(i.e. Total, including 20 mm & 10 mm aggregates)
Volume of 10 mm aggregates taken in concrete = 60%
Volume of 20 mm aggregates taken in concrete = 40%
40% of 1107.41 = 442.96 kg (20 mm aggregates)
10% of 442.96 = 44.29 kg (Tile aggregates)
Therefore,
- Cement – 413.33 kg
- Water – 186 kg
- Fine aggregates – 681.26 kg
- Coarse aggregates –
- Tile aggregates = 44.29 kg
- 10 mm aggregates = 681.26 kg
- 20 mm aggregates = 442.96 – 44.29
= 398.63 kg
Mix proportion for M 30
(20% replacement of normal aggregates with tile aggregates)
Coarse aggregates – 1107.41 kg
(i.e. Total, including 20 mm & 10 mm aggregates)
Now,
Volume of 10 mm aggregates taken in concrete = 60%
Volume of 20 mm aggregates taken in concrete = 40%
40% of 1107.41 = 442.96 kg (20 mm aggregates)
20% of 442.96 = 88.59 kg (Tile aggregates)
Therefore,
- Cement – 413.33 kg
- Water – 186 kg
- Fine aggregates – 681.26 kg
- Coarse aggregates –
- Tile aggregates = 88.59 kg
- 10 mm aggregates = 681.26 kg
- 20 mm aggregates = 442.96 – 88.59
= 354.37 kg
CHAPTER – 5
Discussion of Results
Results of Compressive strength (M20)
TABLE 5.1
(0% replacement of coarse aggregates with tile aggregates)
| Cube No. | No. of days | Load applied (KN) | Compressive strength (N/mm2) | Average strength
(N/ mm2) |
| 1 | 7 | 500 | 22.22 | 21.25 |
| 2 | 7 | 475 | 21.11 | |
| 3 | 7 | 460 | 20.44 | |
| 4 | 28 | 665 | 29.55 | 29.03 |
| 5 | 28 | 650 | 28.88 | |
| 6 | 28 | 645 | 28.66 |
TABLE 5.2
(5% replacement of coarse aggregates with tile aggregates)
| Cube No. | No. of days | Load applied (KN) | Compressive strength (N/mm2) | Average strength
(N/mm2) |
| 1 | 7 | 475 | 21.11 | 20.44 |
| 2 | 7 | 445 | 19.77 | |
| 3 | 7 | 460 | 20.44 | |
| 4 | 28 | 615 | 27.33 | 28.21 |
| 5 | 28 | 690 | 30.66 | |
| 6 | 28 | 600 | 26.66 |
TABLE 5.3
10% replacement of coarse aggregates with tile aggregates
| Cube No. | No. of days | Load applied (KN) | Compressive strength (N/mm2) | Average strength
(N/mm2) |
| 1 | 7 | 410 | 18.22 | 19.55 |
| 2 | 7 | 475 | 21.11 | |
| 3 | 7 | 435 | 19.33 | |
| 4 | 28 | 585 | 26.00 | 27.33 |
| 5 | 28 | 610 | 27.11 | |
| 6 | 28 | 650 | 28.88 |
TABLE 5.4
20% replacement of coarse aggregates with tile aggregates
| Cube No. | No. of days | Load applied (KN) | Compressive strength (N/mm2) | Average strength
(N/mm2) |
| 1 | 7 | 450 | 20.00 | 19.03 |
| 2 | 7 | 435 | 19.33 | |
| 3 | 7 | 400 | 17.77 | |
| 4 | 28 | 640 | 28.44 | 26.81 |
| 5 | 28 | 600 | 26.66 | |
| 6 | 28 | 570 | 25.33 |
M 25 GRADE CONCRETE
TABLE 5.5
0% replacement of coarse aggregates with tile aggregates
| Cube No | No. of days | Load applied (KN) | Compressive strength (N/mm2) | Average strength
(N/mm2) |
| 1 | 7 | 515 | 22.88 | 24.21 |
| 2 | 7 | 550 | 24.44 | |
| 3 | 7 | 570 | 25.33 | |
| 4 | 28 | 820 | 36.44 | 35.62 |
| 5 | 28 | 800 | 35.55 | |
| 6 | 28 | 785 | 34.88 |
TABLE 5.6
5% replacement of coarse aggregates with tile aggregates
| Cube No. | No. of days | Load applied (KN) | Compressive strength (N/mm2) | Average strength
(N/mm2) |
| 1 | 7 | 525 | 23.33 | 23.33 |
| 2 | 7 | 500 | 22.22 | |
| 3 | 7 | 550 | 24.44 | |
| 4 | 28 | 790 | 35.11 | 33.99 |
| 5 | 28 | 745 | 33.11 | |
| 6 | 28 | 760 | 33.77 |
TABLE 5.7
10% replacement of coarse aggregates with tile aggregates
| Cube No | No. of days | Load applied (KN) | Compressive strength (N/mm2) | Average strength
(N/mm2) |
| 1 | 7 | 570 | 25.33 | 24.44 |
| 2 | 7 | 550 | 24.44 | |
| 3 | 7 | 530 | 23.55 | |
| 4 | 28 | 760 | 33.77 | 32.36 |
| 5 | 28 | 725 | 32.22 | |
| 6 | 28 | 700 | 31.11 |
TABLE 5.8
20% replacement of coarse aggregates with tile aggregates
| Cube No | No. of days | Load applied (KN) | Compressive strength (N/mm2) | Average strength
(N/mm2) |
| 1 | 7 | 525 | 23.33 | 23.25 |
| 2 | 7 | 555 | 24.66 | |
| 3 | 7 | 490 | 21.77 | |
| 4 | 28 | 685 | 30.44 | 31.99 |
| 5 | 28 | 730 | 32.44 | |
| 6 | 28 | 745 | 33.11 |
M 30 GRADE CONCRETE
TABLE 5.9
0% replacement of coarse aggregates with tile aggregates
| Cube No. | No. of days | Load applied (KN) | Compressive strength (N/mm2) | Average strength
(N/mm2) |
| 1 | 7 | 730 | 32.44 | 32.29 |
| 2 | 7 | 750 | 33.33 | |
| 3 | 7 | 700 | 31.11 | |
| 4 | 28 | 875 | 38.88 | 38.73 |
| 5 | 28 | 850 | 37.77 | |
| 6 | 28 | 890 | 39.55 |
TABLE 5.10
5% replacement of coarse aggregates with tile aggregates
| Cube No. | No. of days | Load applied (KN) | Compressive strength (N/mm2) | Average
strength (N/mm2) |
| 1 | 7 | 660 | 29.33 | 30.73 |
| 2 | 7 | 700 | 31.11 | |
| 3 | 7 | 715 | 31.77 | |
| 4 | 28 | 795 | 35.33 | 36.73 |
| 5 | 28 | 835 | 37.11 | |
| 6 | 28 | 850 | 37.77 |
TABLE 5.11
10% replacement of coarse aggregates with tile aggregates
| Cube No. | No. of days | Load applied (KN) | Compressive strength (N/mm2) | Average strength
(N/mm2) |
| 1 | 7 | 690 | 30.66 | 29.92 |
| 2 | 7 | 580 | 25.77 | |
| 3 | 7 | 750 | 33.33 | |
| 4 | 28 | 790 | 35.11 | 35.92 |
| 5 | 28 | 855 | 37.11 | |
| 6 | 28 | 800 | 35.55 |
TABLE 5.12
20% replacement of coarse aggregates with tile aggregates
| Cube No. | No. of days | Load applied (KN) | Compressive strength (N/mm2) | Average Strength
(N/mm2) |
| 1 | 7 | 650 | 28.88 | 28.73 |
| 2 | 7 | 665 | 29.55 | |
| 3 | 7 | 625 | 27.77 | |
| 4 | 28 | 770 | 34.22 | 32.96 |
| 5 | 28 | 720 | 32.00 | |
| 6 | 28 | 735 | 32.66 |
TABLE 5.12
Average strength results of M20
| No. of days | Normal | 5% | 10% | 20% |
| 7 | 21.25 | 20.44 | 19.55 | 19.03 |
| 28 | 29.03 | 28.21 | 27.33 | 26.81 |
TABLE 5.13
Average strength results of M25
| No. of days | Normal | 5% | 10% | 20% |
| 7 | 24.21 | 23.33 | 24.44 | 23.25 |
| 28 | 35.62 | 33.99 | 32.36 | 31.99 |
TABLE 5.14
Average strength results of M30
| No. of days | Normal | 5% | 10% | 20% |
| 7 | 32.29 | 30.73 | 29.92 | 28.78 |
| 28 | 38.73 | 36.73 | 35.92 | 32.96 |
TABLE 5.15
| After 7 Days | |||
| Proportion | M20 | M25 | M30 |
| 0% | 21.25 | 24.21 | 32.29 |
| 5% | 20.44 | 23.33 | 30.73 |
| 10% | 19.55 | 24.44 | 30.73 |
| 20% | 19.03 | 23.25 | 28.78 |
TABLE 5.16
| After 28 Days | |||
| Proportion | M20 | M25 | M30 |
| 0% | 29.03 | 35.62 | 38.73 |
| 5% | 28.21 | 33.99 | 36.73 |
| 10% | 27.33 | 32.36 | 35.92 |
| 20% | 26.81 | 31.99 | 32.96 |
CHAPTER – 6
Discussion of Results
6.1 DISCUSSION
Acceptance criteria for concrete –
There are two criteria for concrete to be accepted.
- Target mean strength
- Table 6.2 IS 456 : 2000
Target mean strength –
If the specimens are casted & tested under all precautions at laboratory in a controlled manner then strength of specimens is checked against target mean strength.
Table 6.2 IS 456:2000 –
If the specimens are casted & tested at site somewhere, it is difficult to follow all important precautions & guidelines then to compensate those errors strength of specimens is tested against table 6.2 IS 456:2000.
According to which for the acceptance, these conditions should be met with:
- The mean strength determined from any group of four-non overlapping successive test results should conform with the applicable limits as given in table below.
- Any individual test result complies with in the appropriate limit as given in the table.
TABLE 6.1 – CHARACTERISTICS COMPRESSIVE STRENGTH COMPLIANCE REQUIREMENT
(Table 11 IS 456:2000)
| Specified Concrete grade | Mean of the group of 4 non-overlapping consecutive test results in N/mm2 | Specific test results in N/mm2 |
| Concrete Grade M 20 or Above | >= Characteristics compressive strength + established standard deviation x 0.825
Or Characteristics compressive strength + 4 N/mm2 whichever value is greater |
>= Characteristics compressive strength – 4 N/mm2 |
CONCRETE RESULTS CHEACKING AS PER 1st CRITERIA

Figure 6.1 – Different concrete grades without any aggregate replacement and their respective compressive strength at 7 & 28 days.

Figure 6.2 – Different Concrete Grade represents their obtained compressive strength against their required Target Mean Strength.
- All three grades shows higher strength than required target mean strength, hence all concrete grades are accepted.

Figure 6.3 – Different concrete grades with 5% replacement of natural aggregate with tile aggregate and their respective compressive strength at 7 & 28 days.

FIGURE 6.4 – Different Concrete Grade with 5% replacement of natural aggregates with tile aggregates represents their obtained compressive strength against their Required Target Mean Strength
- In this case also all concrete grades except M-30 show higher strength than required. M-20 and M-25 are accepted.

Figure 6.5 – Different concrete grades with 10% replacement of natural aggregate with tile aggregate and their respective compressive strength at 7 & 28 days.

Aging, Human Illness and Carcinogenesis
FIGURE 6.6 – Different Concrete Grade with 10% replacement of natural aggregates with tile aggregates represents their obtained compressive strength against their Required Target Mean Strength
- Similarly, in this case all grade concrete possess higher strength than required except M-30 and are accepted.CHAPTER I
INTRODUCTION
Aging, human illness and carcinogenesis
Over the last 20 years, it has become increasingly clear that the incidence of solid tumors in human is strongly correlated with aging. In fact, the increase of age is significantly associated for solid tumor carcinogenesis from somatic cells (Ershler and Longo, 1997a). As the age of an organism increases, the incidence of cancer increases. Therefore, cancer has been regarded as an aging-related disease. The curve for cancer incidence starts with an initial flat shape, followed by an inflection point around the age of fifty, from which the incidence of cancer begins to rise exponentially. Based on these observations, it seems reasonable to suggest that there might be possible alterations in certain biological processes and/or cellular reparative pathways that occur at this inflection point, resulting in tumor permissive phenotypes or phenotypes that favor carcinogenesis (Tao et al., 2014).
Aging is a universal process that can be summarized as a decrease in fertility and survival probability. However, the quantification of aging remains relatively undetermined and elusive. To investigate aging-related processes, measuring patterns of longevity seems necessary. The curve of longevity measures how an organism survives over time statistically and illustrates the survival probability across different lifespans. Although the maximum lifespan between species varies enormously, a common pattern emerges from longevity curves across various species ranging from C. elegans to humans (Guarente, 2007; Tao et al., 2014; Zhu et al., 2014). The shape of the C. elegans longevity curve is very similar to the curve of human cancer incidence. It starts with a relatively flat initial slope, representing the initial high survival probability, and followed by an inflection point at roughly two to three weeks, after which the slope of the curve changes rapidly, representing a steep decline in the probability of survival before the maximal longevity of C. elegans. The overall pattern of an inflection point that occurs before the steep slope appears seems to be present in the survival curve of most species. Even though the curves for survival and the incidence of human cancers are inverted, the same pattern is evident: both starts with a flat slope followed by a sharp transition to a steep slope marked by an inflection point (Tao et al., 2014). This raises rather interesting questions: 1) Do the inherent cellular reparative biological processes or genes that are directly related to longevity play a role in the observed increased incidence of solid tumors? 2) For these processes and/or genes, are there alterations of enzymatic activities/gene expressions at the inflection point?
Sirtuins as an aging related protein family that directs the cellular acetylome
Sirtuins (homolog of yeast Sir2) were initially discovered in yeast and C. elegans,and these genes play a critical role in extending the life cycle by suppressing toxic rDNA formation, suggesting a potential role of sirtuins in anti-aging (Guarente, 2007). In addition, it has been shown that the interaction between Sir2 and Ku is required for DNA double-stranded break repair (Boulton and Jackson, 1998). Therefore, loss of sirtuins may play a significant role in the control of the life cycle. Furthermore, analysis of the C. elegans longevity data has suggested that the survival rate of C. elegans has an inflection point that indicates a steep decrease in C. elegans survival (Guarente and Kenyon, 2000; Zhu et al., 2014). Overexpression of sirtuins in C. elegans can shift the inflection point to the right, prolonging their life span; whereas knocking out sirtuins in C. elegans can shift the inflection point to the left, reducing their life span (Guarente and Kenyon, 2000).
Mammalian sirtuins, the class III histone deacetylase family, are different from conventional class I and II histone deacetylases (HDACs) (Donmez and Guarente, 2010; Saunders and Verdin, 2009). Mammalian sirtuins share homology with yeast silent information regulator 2 (Sir2) and use nicotinamide adenine dinucleotide (NAD+) as a cofactor. Seven sirtuins (SIRT1–SIRT7) have been found in humans and localized in different cellular compartments. SIRT1, SIRT6 and SIRT7 are nuclear sirtuins, which function as a regulator of several important transcription factors related to cellular metabolism (Finkel et al., 2009; Guarente, 2008), with SIRT1 being the most intensively studied sirtuin in the nucleus. Studies have investigated whether the loss of a specific sirtuin gene can affect mice life span. Mice, lacking one of the seven sirtuin genes (except Sirt6), do exhibit murine physiological phenotypes similar to that observed in humans for several age-related illnesses, including insulin resistance, cardiovascular disease, neurodegeneration, and most importantly tumorigenesis permissive phenotypes (Donmez and Guarente, 2010; Saunders and Verdin, 2009).
It was first discovered in 2001 that SIRT1 can deacetylate p53 (Vaziri et al., 2001). During DNA damage, SIRT1 is overexpressed and interacts with p53. This results in the deacetylation of p53 at lysine 382, inactivating p53 as a transcription factor. This discovery suggests that during DNA damage response, SIRT1 can inhibit p53 function through deacetylation, therefore reversing damage-induced transcription and reducing the possibility of apoptosis (Vaziri et al., 2001). Later, many other publications have shown that SIRT1 functions to repress the activation of different transcription factors. For example, SIRT1 binds to Hairy-related proteins (bHLH) and represses transcription (Takata and Ishikawa, 2003). Under stress conditions, SIRT1 regulates FOXO transcription factor by increasing its ability of cell cycle arrest and decreasing FOXO3-induced cell death, suggesting that SIRT1 functions to increase longevity by inhibiting apoptosis and increasing stress resistance (Brunet et al., 2004). SIRT1 also binds to forkhead transcription factor and inhibits forkhead-dependent apoptosis, suggesting that SIRT1 can down-regulate different damage-responsive proteins. All these are initial discoveries show SIRT1 increases lifespan through repression of regulation of transcription factors and/or activation of transcription repressors.
Sirtuin proteins dysregulation and their roles in carcinogenesis
More recent discoveries have suggested that SIRT1 may function as a double-sided coin in carcinogenesis, either by suppressing tumor growth or promoting carcinogenesis and resistance to chemo/radiotherapy. There are many publications suggesting that SIRT1 functions as a tumor suppressor protein. SIRT1 fucntions as a tumor suppressor protein in human papillomaviruses (HPV) by regulation E1-E2 mediated DNA replication. Knocking out SIRT1 results in an increase of replication through acetylation and increased stabilization of E2 protein (Das et al., 2017). As a metabolic protein, SIRT1 can regulate glutamine metabolism (Ren et al., 2017). Haploinsufficiency of SIRT1 elevates c-Myc expression, promoting utilization of glutamine, proliferation and tumor cell growth (Ren et al., 2017). In mesenchymal stem cells, overexpression of SIRT1 inhibits breast cancer and prostate cancer cell growth by recruiting nature killer cells and macrophages, suggesting the potential role of SIRT1 in regulating the tumor inflammatory microenvironment (Yu et al., 2016b; Yu et al., 2016c).
On the contrary, there are also many publications indicating SIRT1 as a protein that promotes oncogenesis. For example, hypermethylated in cancer 1 (HIC1) is a transcription factor that functions with p53 and suppresses cancer growth in mice (Chen et al., 2005). However, inactivation of HIC1 results in SIRT1 upregulation and allows cancer cells to bypass DNA damage-induced apoptosis (Chen et al., 2005). Therefore, it is hypothesized that upregulation of SIRT1 may result in an increase of tumor incidence in mammalians cells. Treatment of oxaliplatin, a chemotherapy reagent, functions to inhibit SIRT1-induced p53 deacetylation, activating apoptosis and reducing cyclin D expression. This results in an elongation of the cell cycle and decreases tumor cell proliferation (Chen et al., 2017). SIRT1 has also been shown as a potential indicator of advanced pathological parameter in gastric cancer, and high Beclin-1 and SIRT1 expression correlates with a worse clinical outcome and shorter overall survival (Qiu et al., 2016). In addition, another study in gastric cancer has shown that overexpression of SIRT1 and phosphorylated STAT3 (p-STAT3) is associated with a worse clinical outcome in gastric cancer patients, as advanced stage gastric cancer patients have a higher SIRT1 and p-STAT3 staining. While almost every single protein has dual functions related to carcinogenesis/pathogenesis, it is hypothesized that depending on the type of cancer, SIRT1 may have different functions either as a tumor suppressor protein or as a protein that potentially promotes tumorigenesis.
The only cytoplasmic sirtuin, SIRT2, has similar functions as SIRT1, as it can also provide control over cell cycle progression and genomic stability. For example, loss of SIRT2 results in mammary tumors in female mice and hepatocellular carcinoma (HCC) in male mice. SIRT2 regulates the activity of the anaphase-promoting complex/cyclosome (APC/C) through deacetylation of the APC/C coactivators. Therefore, loss of SIRT2 results in increased mitosis, increased genomic instability, and aneuploidy (Kim et al., 2011). These are all phenotypes observed in different types of cancer, and staining of breast and HCC patient samples suggest that compared with normal tissues, SIRT2 is reduced in tumor samples (Kim et al., 2011). In addition, SIRT2 deacetylates and inactivates the peroxidase activity of peroxiredoxin (Prdx-1), therefore sensitizing cancer cells to DNA damage and cytotoxicity (Fiskus et al., 2016). Furthermore, SIRT2 was downregulated in serous ovarian carcinoma (SOC). Inhibition of SIRT2 in SOC cells results in an increase in tumor cell migration and invasion (Du et al., 2017). Metabolically, loss of SIRT2 results in increased acetylation of PKM2, inhibiting active, tetrameric PKM2 formation and promoting tumorigenesis in Sirt2-/- mammary tumor cells and HeLa cancer cells by inhibiting oxidative phosphorylation and promoting glycolysis (Park et al., 2016b).
However, there are other discoveries suggesting potential roles of SIRT2 in promoting different types of cancer. For example, a study in melanoma suggests that SIRT2 was upregulated in samples with lymph node metastasis (Wilking-Busch et al., 2017). In addition, SIRT2 was found to be upregulated in non-small cell lung cancer cell (NSCLC), and degradation of SIRT2 results in an inhibition of NSCLC growth (Luo et al., 2017). Moreover, overexpression of SIRT2 was found in basal-like breast cancer, as well as deactylating Slug protein at lysine 116 and preventing Slug degradation, and overexpression of Slug protein is associated with basal-like breast cancer aggressiveness (Zhou et al., 2016).
While initial discoveries have suggested that SIRT2 localizes in the cytoplasm and is mainly involved in the regulation of cellular mitosis (Kim et al., 2011; Park et al., 2012), a recent discovery from our laboratory has provided a potentially novel localization of SIRT2, as it can localize in the mitochondria and control autophagy, energy utilization and redox homeostasis (Liu et al., 2016). Specifically, loss of Sirt2 results in an increase of pan-acetylation in mice mitochondrial extracts, suggesting its potential role in regulating mitochondrial acetylation/deacetylation process (Liu et al., 2016). Loss of Sirt2 results in an increase of GSSG:GSH ratio and mitochondrial ROS, suggesting that loss of Sirt2 could create an environment that leads to redox imbalance. Furthermore, loss of Sirt2 decreases cellular respiration capacity, ATP turnover and cellular detoxification, suggesting that SIRT2 may affect metabolic properties as well (Liu et al., 2016). In addition, SIRT2 interacts with many mitochondrial proteins, including SIRT3, suggesting that a potential crosstalk between different sirtuins localized in different cellular compartments may potentially exist.
SIRT3 dysregulation, aberrant intracellular acetylation, and carcinogenesis
Among the sirtuins that are localized in the mitochondria (SIRT3, SIRT4 and SIRT5), SIRT3 is the primary mitochondrial deacetylase (Lombard et al., 2007) and has been demonstrated to be a legitimate tumor suppressor by regulating mitochondrial energy metabolism (Hirschey et al., 2010), limiting the accumulation of mitochondrial ROS (Ahn et al., 2008; Kim et al., 2010). Admittedly, there are discoveries suggesting SIRT3 as a protein that promotes tumorigenesis in gastric cancer and non-small cell lung cancer (Cui et al., 2015; Xiong et al., 2017); however, most discoveries related to SIRT3 suggest that SIRT3 functions as tumor suppressor protein. Because of the mitochondrial localization of SIRT3, one possible explanation why loss of SIRT3 enzymatic activity results in tumor permissive phenotypes can be explained through the aberrant metabolic properties due to loss of SIRT3.
Many additional studies have suggested that SIRT3 plays a critical role in maintaining mitochondrial metabolism homeostasis through its deacetylation activity. It is has been suggested that SIRT3 can regulate mitochondrial energy homeostasis proteins including acetyl-coenzyme A synthetase, long-chain acyl-coenzyme A dehydrogenase, and 3-hydroxy-3-methylglutaryl coenzyme A synthase 2 to respond to nutrient stress (Fritz et al., 2012; Hirschey et al., 2010; Jing et al., 2011; Zhu et al., 2012). SIRT3 also deacetylates ATP synthase F1 complex specifically at lysine 139 of Oligomycin sensitivity-conferring protein (OSCP), and deacetylation of OSCP lysine 139 increases ATP production and mitochondrial energy homeostasis efficiency.
Sixty years ago, Otto Warburg described that tumor cells tend to have aberrant mitochondrial metabolism with a dysregulation of ATP production and mitochondrial energy homeostasis, where cancer cells exhibit higher levels of glucose consumption as compared to their normal counterparts (Warburg, 1956). In this regard, Finley et al have shown that cells lacking Sirt3 exhibit increased glucose consumption (Finley et al., 2011). Loss of Sirt3 increased the stabilization of HIF-1α protein, which functions as a transcription factor that activates multiple cellular pathways including metabolic reprogramming and cancer cell proliferation (Haigis et al., 2012). Loss of Sirt3 increased glucose uptake and lactate production, whereas overexpression of SIRT3 proteins decreased lactate production and suppressed the Warburg effects in cancer cells (Finley et al., 2011). In addition, it has been shown that loss of Sirt3 increased mitochondrial ROS levels, which increases genomic instability, activates HIF-1α and promotes carcinogenesis (Bell et al., 2011; Haigis et al., 2012; Kim et al., 2010; Tao et al., 2010). Similarly, Ozden et al also suggested that loss of SIRT3 enzymatic activity could affect the pyruvate dehydrogenase enzymatic activity and thus promote the cell to a more transformed phenotype and prefer glycolysis (Ozden et al., 2014). These results provide a potential mechanistic link between mitochondrial acetylome, aging, carcinogenesis.
SIRT3 regulation of cellular oxidation / reduction status and/or reactive oxygen species
It is well known that ROS production is closely linked to the mitochondrial energy metabolism and carcinogenesis. As a result of using oxygen to generate ATP, mitochondria produce ROS as a byproduct. Electrons transfer through oxidative phosphorylation (OXPHOS) constitutes a major way of ROS production, since electrons can leak out of complexes I and III, resulting in one-electron reductions of oxygen to produce the superoxide radical (Spitz et al., 2004). Loss of Sirt3 induced increased acetylation of electron transport chain proteins induced higher steady-state levels of ROS (Finley et al., 2011; Vassilopoulos et al., 2014). Not only is SIRT3 involved in ROS production process, it is recently recognized that SIRT3 could also directly regulate the ROS detoxification enzymatic activity through deacetylation of (Manganese superoxide dismutase) (MnSOD) and NADPH production through deacetylation of Isocitrate dehydrogenase 2 (IDH2). On this topic, several studies have demonstrated that MnSOD and IDH2 contain several reversible acetyl lysines and that acetylation alters its enzymatic function (Chen et al., 2011; Qiu et al., 2010; Someya et al., 2010; Tao et al., 2010; Yu et al., 2012).Two mitochondrial target proteins, MnSOD and IDH2, both of which are SIRT3 deacetylation targets, become the main focus of my thesis research, as both are critical regulators for cellular redox balance and detoxification processes.
MnSOD was previously regarded as a simple ROS scavenging enzyme with its activity thought to be only stoichiometrically dependent on the levels of mitochondrial superoxide. However, recent studies have been suggested that MnSOD activity could be regulated by several cellular mechanisms including, transcriptional, translational, and perhaps most importantly, post-translational regulation, depending on the intracellular signals or environmental triggers (Dhar and St Clair, 2012; Hitchler et al., 2008; Huang et al., 1999; Li et al., 2006). Furthermore, intracellular sensing proteins recognizing specific intracellular physiological conditions and initiating post-translational signaling cascades has been known as a fundamental paradigm in biology (Bisht et al., 2003; Gius et al., 1999a; Gius et al., 1999b; Hallahan et al., 1993). Lysine acetylation has recently been regarded as an important post-translational modification mechanism that regulates mitochondrial proteins (Choudhary et al., 2009; Kim et al., 2006; Kouzarides, 2000; Lombard et al., 2007). In this regard, it is logical to hypothesize that MnSOD may contain specific lysine residues, which can be deacetylated by SIRT3.
On this topic, three seminal papers have been published to illustrate how Sirt3 could directly affect MnSOD activity through site-specific deacetylation (Chen et al., 2011; Qiu et al., 2010; Tao et al., 2010). Tao et al. showed that lysine 122 of MnSOD can be targeted for deacetylation by Sirt3. When examining the 3D protein structure of MnSOD, lysine 122 is located near the entrance to the MnSOD inner catalytic core. The data presented in this paper provide significant experimental data to validate the electrostatic facilitation model proposed by Dr. Fridovich (Benovic et al., 1983; Tao et al., 2010; Zhu et al., 2012). Using site-directed mutagenesis, lysine 122 was mutated to an arginine (positive charge mimicking a deacetylated state, MnSODK122R). This mutation induced higher level of MnSOD activity and decreased mitochondrial superoxide level. In contrast, when lysine 122 was mutated to a glutamine (neutral charge mimicking an acetylated state, MnSODK122Q), MnSOD activity was decreased and mitochondrial superoxide level increased. Given the positively charged lysine residue 122 is located close to the entrance of the catalytic core and ideally oriented to provide superoxide anion attraction. Thus it is reasonable to propose the mechanism of increased MnSOD enzymatic activity is due to the attraction of the negatively charged superoxide anion toward the positively charged lysine residues. However, when lysine 122 is acetylated, the electrostatic funnel shows a neutral to negative charge, which repels superoxide anion, therefore, decreasing the possibility of superoxide entering the active site to H2O2 conversion. In addition, the role of MnSOD lysine 122 acetylation in carcinogenesis was confirmed by experiments that infection of Sirt3-/- MEFs with lenti-MnSODK122R but not lenti-MnSODK122Q inhibited in vitro immortalization by an oncogene Ras, or exposure to irradiation (Tao et al., 2010).
Similarly, MnSOD lysine 68 was also suggested to be a potential deacetylation site guided by SIRT3 (Chen et al., 2011). Results showed that SIRT3 was able to deacetylate MnSOD at lysine 68 and further increase the enzymatic activity of MnSOD. It is also shown that when cells challenged with DMNQ, a reagent that is known to increase mitochondria ROS level, Sirt3 can be stimulated and further lead to MnSOD activation by deacetylation and protect cells from increased intracellular mitochondrial ROS. All these studies showed that SIRT3 could physically interact with MnSOD and deacetylate MnSOD in cell-free, in vitro, and in vivo (murine) model systems. In addition, loss of SIRT3 in different cell lines resulted in increased intracellular and mitochondrial superoxide levels, whereas overexpression of WT SIRT3 but not the deacetylation-null, decreased cellular ROS and mitochondrial superoxide levels (Kim et al., 2010; Tao et al., 2010). The deacetylation of lysine 68 and 122 significantly increases the MnSOD enzymatic activity and thus protecting cells from ROS induced genomic instability and other deleterious effects (Chen et al., 2011; Jing et al., 2011; Tao et al., 2010). In addition, it is now well documented that MnSOD activity is decreased in early breast cancer and several sources have demonstrated that MnSOD plays a critical role in breast cancer cell proliferation, as well as metastasis through controlling the superoxide and hydrogen peroxide production to activate several redox-sensitive survival and proliferation related cell signaling pathways (Becuwe et al., 2014; Kaewpila et al., 2008; Kattan et al., 2008; Li et al., 1995; Sarsour et al., 2012; Vera-Ramirez et al., 2011; Wang et al., 2005)
IDH2, another mitochondrial protein, has been shown to be a SIRT3 deacetylation target. IDH2 was regarded as an enzyme that functions in the TCA cycle. Its primary role is to oxidize isocitrate into alpha-ketoglutarate (α-KG). The active form of IDH2 is a homodimer that binds to isocitrate and NADP+ and catalyzes the production of α-KG and NADPH. NADPH is long regarded as a reducing reagent that functions to remove ROS and reproduce GSH for cellular detoxification (Rush et al., 1985). Therefore, IDH2 is regarded as a critical metabolic and detoxification enzyme in the TCA cycle that supports mitochondrial integrity and energy homeostasis. On the other hand, genetic loss of IDH2 in mice has been associated with mitochondrial dysfunction, neurotoxicity, and potentially cardiac hypertrophy and Parkinson’s disease (Kim et al., 2016; Ku et al., 2015; Park et al., 2016a), suggesting the role of IDH2 in mitochondrial metabolism and pathogenesis due to dysregulated mitochondrial energy homeostasis and/or detoxification.
Loss of SIRT3 enzymatic activity results in an increase of IDH2 acetylation at lysine 413. Loss of IDH2 enzymatic activity due to acetylation of IDH2 at lysine 413 increases GSSG / GSH ratio, increases mitochondrial ROS levels, and is associated with B cell malignancy (Yu et al., 2016a; Yu et al., 2012). Furthermore, studies also suggested that the induction of deacetylation activity also appears to protect against the development of age-related human pathology, including carcinogensis (Kim et al., 2010; Someya et al., 2010). Thus, with these results, it is logical to propose that SIRT3 functions as a sensing or fidelity protein which can regulate downstream targets through post-translational modifications involving protein acetylation to modify cellular metabolism and redox balance and may be involved in aging-related diseases like cancer.
Three seminal papers have been published to illustrate how SIRT3 could directly affect IDH2 activity through site-specific deacetylation (Yu et al., 2012). It was first shown that caloric restriction (CR) extends the lifespan of mice by activating SIRT3 and IDH2. Activation of IDH2 and SIRT3 by CR reduced oxidative stresses in mice and prevented acute hearing loss. In addition, overexpression of SIRT3 increased NADPH levels and protects cells from oxidative stress (Someya et al., 2010). Later, Yu et al. showed that lysine 413 of IDH2 can be targeted for deacetylation by SIRT3. When examining the 3D protein structure of IDH2, lysine 413 is located near the catalytic NADP+ binding site of IDH2. Using site-directed mutagenesis, lysine 413 was mutated to an arginine (positive charge mimicking a deacetylated state, IDH2K413R). This mutation induced higher levels of IDH2 activity and decreased mitochondrial superoxide levels. In contrast, when lysine 413 was mutated to a glutamine (neutral charge mimicking an acetylated state, IDH2K413Q), IDH2 activity significantly decreased, the Km value for isocitrate and NADP+ binding significantly increased, the Vmax decreased, and the GSSG / GSH ratio significantly increased (Yu et al., 2012). Thus, it is reasonable to propose that the mechanism of decreased IDH2 enzymatic activity is that when lysine 413 is acetylated, the inability to bind to NADP+ and isocitrate decreases the association of IDH2 monomeric proteins, and therefore decreases the formation of IDH2 homodimers.
Several years later, Yu et al. published another manuscript suggesting that loss of SIRT3 enzymatic activity provides a growth advantage for malignant B cells (Yu et al., 2016a). They discovered that in malignant B cells, SIRT3 protein levels and SIRT3 mRNA levels were lower compared to normal B cells, resulting in a higher IDH2 acetylation levels and a higher Ki67 percentage. In addition, these cells possess higher mitochondrial ROS levels. All these pathological and biochemical phenotypes provide a growth advantage for B cell malignancy. Overall, all these properties associated with loss of SIRT3 enzymatic activity and IDH2 acetylation at lysine 413 suggest that dysregulated IDH2 acetylation, due to loss of SIRT3 enzymatic activity, can provide at least partial explanations of tumor permissive phenotypes and/or tumorigenesis related to Sirt3 loss.
Overall, cells lacking Sirt3 may have dysfunctional coordination of both mitochondrial energy metabolism and detoxification enzymes, which can ultimately result in aberrant and potentially damaging ROS production that may have deleterious biological effects. All these results related to SIRT3, mitochondrial energy homeostasis, ROS production and detoxification also raise several important questions regarding the role of SIRT3 in carcinogenesis that include: (1) what are the roles of sirtuins, specifically SIRT3, in tumorigenesis? (2) how are sirtuins, specifically SIRT3, involved in regulation of cancer cell metabolism, proliferation and metastasis through site-specific acetylation/deacetylation?
SIRT3 is a breast cancer tumor suppressor protein
While mice lacking one of the seven sirtuin genes do not exhibit changes in life span, these mice exhibit physiological phenotypes for several age-related illness, including insulin resistance, cardiovascular disease, neurodegeneration, and most importantly a tumorigenesis permissive phenotype (Desouki et al., 2014). Recently, the Gius laboratory created a Sirt3 knock-out mouse model, and these mice not only exhibit dysregulated mitochondrial detoxification pathways but also contain increased cellular and mitochondrial reactive oxygen species (ROS). In addition, the mice lacking Sirt3 develop estrogen receptor positive (ER+) mammary tumors that display high Ki-67 and are poorly differentiated with poor prognosis, and this histopathology is similar to that observed in women with luminal B breast malignancies (Desouki et al., 2014; Kim et al., 2010; Tao et al., 2010).
Breast cancer is the most common and frequent cancer among women in the US, and it is the second cause of cancer death in women worldwide (Fadoukhair et al., 2015; Lumachi et al., 2015). The expected number of new breast cancer cases in the US is approximately 231800 in 2015, which accounts for 29% of all cancers (Lumachi et al., 2015). Breast cancers are categorized into four different subtypes with different molecular characteristics: luminal A, luminal B, HER2 and triple negative breast cancer (Perou et al., 2000). The luminal A and luminal B breast cancer are hormone-receptor positive breast cancers (Fadoukhair et al., 2015). Specifically, the estrogen receptor (ER) and/or progesterone receptor (PR) are expressed in both luminal A and luminal B breast cancer, the latter showing high (more than 14% positive using IHC staining) proliferation signature gene expression (Ki67) and/or oncogenic human epidermal growth factor receptor 2 (HER2) expression (Goldhirsch et al., 2011; Mitri et al., 2012; Perez et al., 2015). HER2 and triple-negative breast cancer are hormone-receptor negative breast cancers, with the former showing HER2 overexpression, and triple negative regarded as the most aggressive breast cancer (Goldhirsch et al., 2011).
Receptor positive breast cancer (luminal A and luminal B) accounts for approximately 80% of all breast cancers (Lumachi et al., 2015). Endocrine therapy has been mainly used in receptor positive breast cancer treatment (Lumachi et al., 2015). There are several endocrine therapy methods, including ovarian function suppression (OFS), selective estrogen receptor modulators or down-regulators (SERMs or SERDs) and aromatase inhibitors (AIs) (Lumachi et al., 2015). OFS is used to suppress ovarian function, which secretes estrogen and progesterone (Love et al., 2015). Surgical removal of ovaries and gonadotropin-releasing hormone agonists (GnRHa) has been used to obtain OFS (Lumachi et al., 2015; Vitek et al., 2014). The most well-known SERM is tamoxifen (TAM), which blocks ER signaling in the breast and brain selectively (Lumachi et al., 2013; Lumachi et al., 2015). TAM mainly benefits ER+ breast cancer patients by reducing the recurrence and mortality rate (Early Breast Cancer Trialists’ Collaborative et al., 2011; Lumachi et al., 2015). Fulvestrant is the only SERD approved by the FDA (Lumachi et al., 2015). It functions as an ER antagonist with no estrogen agonist activity, binding to ER and preventing ER dimerization and relocalization (Croxtall and McKeage, 2011; Dauvois et al., 1993). AIs inhibit the cytochrome P450 component of the aromatase enzyme complex to prevent estrogen biosynthesis (Mokbel, 2002).
Despite the similarity in the treatment between luminal A and luminal B breast cancer, given the impact of proliferative and oncogenic genes in luminal B breast cancer, luminal B patients have a worse clinical outcome than luminal A patients (Goldhirsch et al., 2011; Perou et al., 2000). Pathologically, luminal B patients have a worse tumor grade and a larger tumor size than luminal A patients (Carey et al., 2006; Haque et al., 2012). Genetically, luminal B patients have a higher p53 mutation rate compared to luminal A patients, resulting in poor prognosis (Carey et al., 2006; Haque et al., 2012). Statistically, luminal B patients have a lower probability of five-year relapse-free survival rate, disease specific survival rate, overall survival rate and distant metastasis-free survival rate compared to luminal A breast cancer patients (Creighton, 2012; Jenkins et al., 2014; Parker et al., 2009). In addition, higher Ki67 expression found in luminal B breast cancer patients is correlated with higher relapse rate (Ellis et al., 2008). Because of its proliferative characteristics, luminal B breast cancer has become less responsive to chemotherapy and endocrine therapy, and approximately 30% of receptor positive breast cancer did not benefit from endocrine therapy at all (Allred et al., 2004; Creighton, 2012).
Receptor negative breast cancers, including HER2 and triple negative breast cancers, typically have a worse clinical outcome. Metastasis to brain is higher in these two breast cancer subtypes, and patients with HER2 or triple negative breast cancer have a lower survival rate (Martin et al., 2017). Despite the differences of breast cancer subtypes, all four types of breast cancer share a similarity with many other types of cancer, as cancer is an aging-related disease. The data for solid tumors in human suggest that as the age increases, an inflection point that indicates an exponential increase in human cancer incidence occurs after 50 years old (Zhu et al., 2014). Approximately half of the newly diagnosed breast cancer patients are older than 65 years (Barginear et al., 2014; Siegel et al., 2012). Furthermore, luminal B breast cancer patients older than 60 years have a two-fold increase in luminal B incidence compared to patients between 40 and 59 years old, whereas the incidence of luminal A breast cancer remains relatively constant among different age groups (Creighton, 2012). Therefore, the incidence of luminal B breast cancer is linked with aging and aging related genes. One evolutionally preserved aging-related gene that can result in luminal B breast cancer incidence is sirtuins.
To further understand the role of SIRT3 in breast carcinogenesis, our laboratory has shown that Sirt3 knock out mouse embryonic fibroblasts (MEFs) exhibited significantly higher levels of genomic instability and could be immortalized by infection with a single oncogene, either Myc or Ras. In addition, these immortalized MEFs were able to grow in low density, soft agar and become tumorigenic in nude mice (Kim et al., 2010). These results strongly suggest that loss of Sirt3 results in a tumor-permissive phenotype in mice. More importantly, Sirt3-/- mice developed mammary gland tumors over 24 months, while no Sirt3+/+ mice developed mammary tumors during the same period. Interestingly, Histological H&E and immunohistochemistry (IHC) staining identified these tumors as estrogen receptor and progesterone receptor (ER/PR) positive. These results further suggested that Sirt3-/- mice developed mammary gland tumors parallel a well-differentiated, receptor-positive histological characteristic that is commonly observed in breast malignancies in older women (Kim et al., 2010). Finally, using human breast cancer sample sets including SIRT3 expression and Sirt3 RNA levels also showed that SIRT3 expression was significantly lower in breast cancer samples as compared to normal control and negatively correlates breast cancer malignancy (Kim et al., 2010). Together, results from in vitro, in vivo and human studies strongly support the hypothesis that SIRT3 is a genomic expressed, mitochondrial localized tumor suppressor protein.
More importantly, sirtuins have been suggested to play a role in anti-aging and receptor positive breast cancer are most common in post-menopausal women, which incidence increases slowly until the mid 60’s when a significant increase in incidence is observed (Ershler and Longo, 1997a, b). In this regard, results of Sirt3 knockout mice developing ER-positive breast cancer provide a convincing argument that SIRT3 may function as critical regulators at the crossroads between metabolic regulations, aging and aging related human diseases like breast cancer, and loss of Sirt3 would contribute to creating a tumor permissive environment. Therefore, in my thesis, the overarching goal is to study how does the aberrant acetylation of mitochondrial proteins (IDH2 and MnSOD), due to loss of SIRT3 enzymatic activity, can result in an inbalanced redox environment and energy homeostasis, therefore promoting tumorigenesis and tumor permissive phenotypes.
Ahn, B.H., Kim, H.S., Song, S., Lee, I.H., Liu, J., Vassilopoulos, A., Deng, C.X., and Finkel, T. (2008). A role for the mitochondrial deacetylase Sirt3 in regulating energy homeostasis. Proc Natl Acad Sci U S A 105, 14447-14452.
Allred, D.C., Brown, P., and Medina, D. (2004). The origins of estrogen receptor alpha-positive and estrogen receptor alpha-negative human breast cancer. Breast Cancer Res 6, 240-245.
Barginear, M.F., Muss, H., Kimmick, G., Owusu, C., Mrozek, E., Shahrokni, A., Ballman, K., and Hurria, A. (2014). Breast cancer and aging: results of the U13 conference breast cancer panel. Breast Cancer Res Treat 146, 1-6.
Becuwe, P., Ennen, M., Klotz, R., Barbieux, C., and Grandemange, S. (2014). Manganese superoxide dismutase in breast cancer: from molecular mechanisms of gene regulation to biological and clinical significance. Free Radic Biol Med 77, 139-151.
Bell, E.L., Emerling, B.M., Ricoult, S.J., and Guarente, L. (2011). SirT3 suppresses hypoxia inducible factor 1alpha and tumor growth by inhibiting mitochondrial ROS production. Oncogene 30, 2986-2996.
Benovic, J., Tillman, T., Cudd, A., and Fridovich, I. (1983). Electrostatic facilitation of the reaction catalyzed by the manganese-containing and the iron-containing superoxide dismutases. Archives of biochemistry and biophysics 221, 329-332.
Bisht, K.S., Bradbury, C.M., Mattson, D., Kaushal, A., Sowers, A., Markovina, S., Ortiz, K.L., Sieck, L.K., Isaacs, J.S., Brechbiel, M.W., et al. (2003). Geldanamycin and 17-allylamino-17-demethoxygeldanamycin potentiate the in vitro and in vivo radiation response of cervical tumor cells via the heat shock protein 90-mediated intracellular signaling and cytotoxicity. Cancer Res 63, 8984-8995.
Boulton, S.J., and Jackson, S.P. (1998). Components of the Ku-dependent non-homologous end-joining pathway are involved in telomeric length maintenance and telomeric silencing. EMBO J 17, 1819-1828.
Brunet, A., Sweeney, L.B., Sturgill, J.F., Chua, K.F., Greer, P.L., Lin, Y., Tran, H., Ross, S.E., Mostoslavsky, R., Cohen, H.Y., et al. (2004). Stress-dependent regulation of FOXO transcription factors by the SIRT1 deacetylase. Science 303, 2011-2015.
Carey, L.A., Perou, C.M., Livasy, C.A., Dressler, L.G., Cowan, D., Conway, K., Karaca, G., Troester, M.A., Tse, C.K., Edmiston, S., et al. (2006). Race, breast cancer subtypes, and survival in the Carolina Breast Cancer Study. JAMA 295, 2492-2502.
Chen, H.Y., Cheng, H.L., Lee, Y.H., Yuan, T.M., Chen, S.W., Lin, Y.Y., and Chueh, P.J. (2017). Tumor-associated NADH oxidase (tNOX)-NAD+-sirtuin 1 axis contributes to oxaliplatin-induced apoptosis of gastric cancer cells. Oncotarget.
Chen, W.Y., Wang, D.H., Yen, R.C., Luo, J., Gu, W., and Baylin, S.B. (2005). Tumor suppressor HIC1 directly regulates SIRT1 to modulate p53-dependent DNA-damage responses. Cell 123, 437-448.
Chen, Y., Zhang, J., Lin, Y., Lei, Q., Guan, K.L., Zhao, S., and Xiong, Y. (2011). Tumour suppressor SIRT3 deacetylates and activates manganese superoxide dismutase to scavenge ROS. EMBO reports 12, 534-541.
Choudhary, C., Kumar, C., Gnad, F., Nielsen, M.L., Rehman, M., Walther, T.C., Olsen, J.V., and Mann, M. (2009). Lysine acetylation targets protein complexes and co-regulates major cellular functions. Science 325, 834-840.
Creighton, C.J. (2012). The molecular profile of luminal B breast cancer. Biologics 6, 289-297.
Croxtall, J.D., and McKeage, K. (2011). Fulvestrant: a review of its use in the management of hormone receptor-positive metastatic breast cancer in postmenopausal women. Drugs 71, 363-380.
Cui, Y., Qin, L., Wu, J., Qu, X., Hou, C., Sun, W., Li, S., Vaughan, A.T., Li, J.J., and Liu, J. (2015). SIRT3 Enhances Glycolysis and Proliferation in SIRT3-Expressing Gastric Cancer Cells. PLoS One 10, e0129834.
Das, D., Smith, N., Wang, X., and Morgan, I.M. (2017). The deacetylase SIRT1 regulates the replication properties of human papillomavirus 16 E1 and E2. J Virol.
Dauvois, S., White, R., and Parker, M.G. (1993). The antiestrogen ICI 182780 disrupts estrogen receptor nucleocytoplasmic shuttling. J Cell Sci 106 ( Pt 4), 1377-1388.
Desouki, M.M., Doubinskaia, I., Gius, D., and Abdulkadir, S.A. (2014). Decreased mitochondrial SIRT3 expression is a potential molecular biomarker associated with poor outcome in breast cancer. Human pathology 45, 1071-1077.
Dhar, S.K., and St Clair, D.K. (2012). Manganese superoxide dismutase regulation and cancer. Free Radic Biol Med 52, 2209-2222.
Donmez, G., and Guarente, L. (2010). Aging and disease: connections to sirtuins. Aging Cell 9, 285-290.
Du, Y., Wu, J., Zhang, H., Li, S., and Sun, H. (2017). Reduced expression of SIRT2 in serous ovarian carcinoma promotes cell proliferation through disinhibition of CDK4 expression. Mol Med Rep.
Early Breast Cancer Trialists’ Collaborative, G., Davies, C., Godwin, J., Gray, R., Clarke, M., Cutter, D., Darby, S., McGale, P., Pan, H.C., Taylor, C., et al. (2011). Relevance of breast cancer hormone receptors and other factors to the efficacy of adjuvant tamoxifen: patient-level meta-analysis of randomised trials. Lancet 378, 771-784.
Ellis, M.J., Tao, Y., Luo, J., A’Hern, R., Evans, D.B., Bhatnagar, A.S., Chaudri Ross, H.A., von Kameke, A., Miller, W.R., Smith, I., et al. (2008). Outcome prediction for estrogen receptor-positive breast cancer based on postneoadjuvant endocrine therapy tumor characteristics. J Natl Cancer Inst 100, 1380-1388.
Ershler, W.B., and Longo, D.L. (1997a). Aging and cancer: issues of basic and clinical science. J Natl Cancer Inst 89, 1489-1497.
Ershler, W.B., and Longo, D.L. (1997b). The biology of aging: the current research agenda. Cancer 80, 1284-1293.
Fadoukhair, Z., Zardavas, D., Chad, M.A., Goulioti, T., Aftimos, P., and Piccart, M. (2015). Evaluation of targeted therapies in advanced breast cancer: the need for large-scale molecular screening and transformative clinical trial designs. Oncogene.
Finkel, T., Deng, C.X., and Mostoslavsky, R. (2009). Recent progress in the biology and physiology of sirtuins. Nature 460, 587-591.
Finley, L.W., Carracedo, A., Lee, J., Souza, A., Egia, A., Zhang, J., Teruya-Feldstein, J., Moreira, P.I., Cardoso, S.M., Clish, C.B., et al. (2011). SIRT3 opposes reprogramming of cancer cell metabolism through HIF1alpha destabilization. Cancer Cell 19, 416-428.
Fiskus, W., Coothankandaswamy, V., Chen, J., Ma, H., Ha, K., Saenz, D.T., Krieger, S.S., Mill, C.P., Sun, B., Huang, P., et al. (2016). SIRT2 Deacetylates and Inhibits the Peroxidase Activity of Peroxiredoxin-1 to Sensitize Breast Cancer Cells to Oxidant Stress-Inducing Agents. Cancer Res 76, 5467-5478.
Fritz, K.S., Galligan, J.J., Hirschey, M.D., Verdin, E., and Petersen, D.R. (2012). Mitochondrial Acetylome Analysis in a Mouse Model of Alcohol-Induced Liver Injury Utilizing SIRT3 Knockout Mice. Journal of proteome research 11, 1633-1643.
Gius, D., Botero, A., Shah, S., and Curry, H.A. (1999a). Intracellular oxidation/reduction status in the regulation of transcription factors NF-kappaB and AP-1. Toxicol Lett 106, 93-106.
Gius, D.R., Ezhevsky, S.A., Becker-Hapak, M., Nagahara, H., Wei, M.C., and Dowdy, S.F. (1999b). Transduced p16INK4a peptides inhibit hypophosphorylation of the retinoblastoma protein and cell cycle progression prior to activation of Cdk2 complexes in late G1. Cancer Res 59, 2577-2580.
Goldhirsch, A., Wood, W.C., Coates, A.S., Gelber, R.D., Thurlimann, B., Senn, H.J., and Panel, m. (2011). Strategies for subtypes–dealing with the diversity of breast cancer: highlights of the St. Gallen International Expert Consensus on the Primary Therapy of Early Breast Cancer 2011. Ann Oncol 22, 1736-1747.
Guarente, L. (2007). Sirtuins in aging and disease. Cold Spring Harbor symposia on quantitative biology 72, 483-488.
Guarente, L. (2008). Mitochondria–a nexus for aging, calorie restriction, and sirtuins? Cell 132, 171-176.
Guarente, L., and Kenyon, C. (2000). Genetic pathways that regulate ageing in model organisms. Nature 408, 255-262.
Haigis, M.C., Deng, C.X., Finley, L.W., Kim, H.S., and Gius, D. (2012). SIRT3 is a mitochondrial tumor suppressor: a scientific tale that connects aberrant cellular ROS, the Warburg effect, and carcinogenesis. Cancer Res 72, 2468-2472.
Hallahan, D.E., Gius, D., Kuchibhotla, J., Sukhatme, V., Kufe, D.W., and Weichselbaum, R.R. (1993). Radiation signaling mediated by Jun activation following dissociation from a cell type-specific repressor. J Biol Chem 268, 4903-4907.
Haque, R., Ahmed, S.A., Inzhakova, G., Shi, J., Avila, C., Polikoff, J., Bernstein, L., Enger, S.M., and Press, M.F. (2012). Impact of breast cancer subtypes and treatment on survival: an analysis spanning two decades. Cancer Epidemiol Biomarkers Prev 21, 1848-1855.
Hirschey, M.D., Shimazu, T., Goetzman, E., Jing, E., Schwer, B., Lombard, D.B., Grueter, C.A., Harris, C., Biddinger, S., Ilkayeva, O.R., et al. (2010). SIRT3 regulates mitochondrial fatty-acid oxidation by reversible enzyme deacetylation. Nature 464, 121-125.
Hitchler, M.J., Oberley, L.W., and Domann, F.E. (2008). Epigenetic silencing of SOD2 by histone modifications in human breast cancer cells. Free Radic Biol Med 45, 1573-1580.
Huang, Y., He, T., and Domann, F.E. (1999). Decreased expression of manganese superoxide dismutase in transformed cells is associated with increased cytosine methylation of the SOD2 gene. DNA Cell Biol 18, 643-652.
Jenkins, E.O., Deal, A.M., Anders, C.K., Prat, A., Perou, C.M., Carey, L.A., and Muss, H.B. (2014). Age-specific changes in intrinsic breast cancer subtypes: a focus on older women. Oncologist 19, 1076-1083.
Jing, E., Emanuelli, B., Hirschey, M.D., Boucher, J., Lee, K.Y., Lombard, D., Verdin, E.M., and Kahn, C.R. (2011). Sirtuin-3 (Sirt3) regulates skeletal muscle metabolism and insulin signaling via altered mitochondrial oxidation and reactive oxygen species production. Proc Natl Acad Sci U S A 108, 14608-14613.
Kaewpila, S., Venkataraman, S., Buettner, G.R., and Oberley, L.W. (2008). Manganese superoxide dismutase modulates hypoxia-inducible factor-1 alpha induction via superoxide. Cancer Res 68, 2781-2788.
Kattan, Z., Minig, V., Leroy, P., Dauca, M., and Becuwe, P. (2008). Role of manganese superoxide dismutase on growth and invasive properties of human estrogen-independent breast cancer cells. Breast Cancer Res Treat 108, 203-215.
Kim, H., Kim, S.H., Cha, H., Kim, S.R., Lee, J.H., and Park, J.W. (2016). IDH2 deficiency promotes mitochondrial dysfunction and dopaminergic neurotoxicity: implications for Parkinson’s disease. Free Radic Res 50, 853-860.
Kim, H.S., Patel, K., Muldoon-Jacobs, K., Bisht, K.S., Aykin-Burns, N., Pennington, J.D., van der Meer, R., Nguyen, P., Savage, J., Owens, K.M., et al. (2010). SIRT3 is a mitochondria-localized tumor suppressor required for maintenance of mitochondrial integrity and metabolism during stress. Cancer Cell 17, 41-52.
Kim, H.S., Vassilopoulos, A., Wang, R.H., Lahusen, T., Xiao, Z., Xu, X., Li, C., Veenstra, T.D., Li, B., Yu, H., et al. (2011). SIRT2 maintains genome integrity and suppresses tumorigenesis through regulating APC/C activity. Cancer Cell 20, 487-499.
Kim, S.C., Sprung, R., Chen, Y., Xu, Y., Ball, H., Pei, J., Cheng, T., Kho, Y., Xiao, H., Xiao, L., et al. (2006). Substrate and functional diversity of lysine acetylation revealed by a proteomics survey. Molecular cell 23, 607-618.
Kouzarides, T. (2000). Acetylation: a regulatory modification to rival phosphorylation? Embo J 19, 1176-1179.
Ku, H.J., Ahn, Y., Lee, J.H., Park, K.M., and Park, J.W. (2015). IDH2 deficiency promotes mitochondrial dysfunction and cardiac hypertrophy in mice. Free Radic Biol Med 80, 84-92.
Li, J.J., Oberley, L.W., St Clair, D.K., Ridnour, L.A., and Oberley, T.D. (1995). Phenotypic changes induced in human breast cancer cells by overexpression of manganese-containing superoxide dismutase. Oncogene 10, 1989-2000.
Li, M., Chiu, J.F., Mossman, B.T., and Fukagawa, N.K. (2006). Down-regulation of manganese-superoxide dismutase through phosphorylation of FOXO3a by Akt in explanted vascular smooth muscle cells from old rats. J Biol Chem 281, 40429-40439.
Liu, G., Park, S.H., Imbesi, M., Nathan, W.J., Zou, X., Zhu, Y., Jiang, H., Parisiadou, L., and Gius, D. (2016). Loss of NAD-Dependent Protein Deacetylase Sirtuin-2 Alters Mitochondrial Protein Acetylation and Dysregulates Mitophagy. Antioxid Redox Signal.
Lombard, D.B., Alt, F.W., Cheng, H.L., Bunkenborg, J., Streeper, R.S., Mostoslavsky, R., Kim, J., Yancopoulos, G., Valenzuela, D., Murphy, A., et al. (2007). Mammalian Sir2 homolog SIRT3 regulates global mitochondrial lysine acetylation. Molecular and cellular biology 27, 8807-8814.
Love, R.R., Laudico, A.V., Van Dinh, N., Allred, D.C., Uy, G.B., Quang le, H., Salvador, J.D., Siguan, S.S., Mirasol-Lumague, M.R., Tung, N.D., et al. (2015). Timing of adjuvant surgical oophorectomy in the menstrual cycle and disease-free and overall survival in premenopausal women with operable breast cancer. J Natl Cancer Inst 107, djv064.
Lumachi, F., Brunello, A., Maruzzo, M., Basso, U., and Basso, S.M. (2013). Treatment of estrogen receptor-positive breast cancer. Curr Med Chem 20, 596-604.
Lumachi, F., Santeufemia, D.A., and Basso, S.M. (2015). Current medical treatment of estrogen receptor-positive breast cancer. World J Biol Chem 6, 231-239.
Luo, J., Bao, Y.C., Ji, X.X., Chen, B., Deng, Q.F., and Zhou, S.W. (2017). SPOP promotes SIRT2 degradation and suppresses non-small cell lung cancer cell growth. Biochem Biophys Res Commun 483, 880-884.
Martin, A.M., Cagney, D.N., Catalano, P.J., Warren, L.E., Bellon, J.R., Punglia, R.S., Claus, E.B., Lee, E.Q., Wen, P.Y., Haas-Kogan, D.A., et al. (2017). Brain Metastases in Newly Diagnosed Breast Cancer: A Population-Based Study. JAMA Oncol.
Mitri, Z., Constantine, T., and O’Regan, R. (2012). The HER2 Receptor in Breast Cancer: Pathophysiology, Clinical Use, and New Advances in Therapy. Chemother Res Pract 2012, 743193.
Mokbel, K. (2002). The evolving role of aromatase inhibitors in breast cancer. Int J Clin Oncol 7, 279-283.
Ozden, O., Park, S.H., Wagner, B.A., Yong Song, H., Zhu, Y., Vassilopoulos, A., Jung, B., Buettner, G.R., and Gius, D. (2014). SIRT3 deacetylates and increases pyruvate dehydrogenase activity in cancer cells. Free Radic Biol Med 76, 163-172.
Park, J.B., Nagar, H., Choi, S., Jung, S.B., Kim, H.W., Kang, S.K., Lee, J.W., Lee, J.H., Park, J.W., Irani, K., et al. (2016a). IDH2 deficiency impairs mitochondrial function in endothelial cells and endothelium-dependent vasomotor function. Free Radic Biol Med 94, 36-46.
Park, S.H., Ozden, O., Liu, G., Song, H.Y., Zhu, Y., Yan, Y., Zou, X., Kang, H.J., Jiang, H., Principe, D.R., et al. (2016b). SIRT2-Mediated Deacetylation and Tetramerization of Pyruvate Kinase Directs Glycolysis and Tumor Growth. Cancer Res 76, 3802-3812.
Park, S.H., Zhu, Y., Ozden, O., Kim, H.S., Jiang, H., Deng, C.X., Gius, D., and Vassilopoulos, A. (2012). SIRT2 is a tumor suppressor that connects aging, acetylome, cell cycle signaling, and carcinogenesis. Transl Cancer Res 1, 15-21.
Parker, J.S., Mullins, M., Cheang, M.C., Leung, S., Voduc, D., Vickery, T., Davies, S., Fauron, C., He, X., Hu, Z., et al. (2009). Supervised risk predictor of breast cancer based on intrinsic subtypes. J Clin Oncol 27, 1160-1167.
Perez, A.A., Balabram, D., Rocha, R.M., da Silva Souza, A., and Gobbi, H. (2015). Co-Expression of p16, Ki67 and COX-2 Is Associated with Basal Phenotype in High-Grade Ductal Carcinoma In Situ of the Breast. J Histochem Cytochem 63, 408-416.
Perou, C.M., Sorlie, T., Eisen, M.B., van de Rijn, M., Jeffrey, S.S., Rees, C.A., Pollack, J.R., Ross, D.T., Johnsen, H., Akslen, L.A., et al. (2000). Molecular portraits of human breast tumours. Nature 406, 747-752.
Qiu, G., Li, X., Wei, C., Che, X., He, S., Lu, J., Wang, S., Pang, K., and Fan, L. (2016). The Prognostic Role of SIRT1-Autophagy Axis in Gastric Cancer. Dis Markers 2016, 6869415.
Qiu, X., Brown, K., Hirschey, M.D., Verdin, E., and Chen, D. (2010). Calorie restriction reduces oxidative stress by SIRT3-mediated SOD2 activation. Cell metabolism 12, 662-667.
Ren, N.S., Ji, M., Tokar, E.J., Busch, E.L., Xu, X., Lewis, D., Li, X., Jin, A., Zhang, Y., Wu, W.K., et al. (2017). Haploinsufficiency of SIRT1 Enhances Glutamine Metabolism and Promotes Cancer Development. Curr Biol 27, 483-494.
Rush, G.F., Gorski, J.R., Ripple, M.G., Sowinski, J., Bugelski, P., and Hewitt, W.R. (1985). Organic hydroperoxide-induced lipid peroxidation and cell death in isolated hepatocytes. Toxicol Appl Pharmacol 78, 473-483.
Sarsour, E.H., Kalen, A.L., Xiao, Z., Veenstra, T.D., Chaudhuri, L., Venkataraman, S., Reigan, P., Buettner, G.R., and Goswami, P.C. (2012). Manganese superoxide dismutase regulates a metabolic switch during the mammalian cell cycle. Cancer Res 72, 3807-3816.
Saunders, L.R., and Verdin, E. (2009). Cell biology. Stress response and aging. Science 323, 1021-1022.
Siegel, R., DeSantis, C., Virgo, K., Stein, K., Mariotto, A., Smith, T., Cooper, D.,
Acquisition and Transmission of Basic Environmental Factors for Agriculture using Internet-of-Things Concept
Gansler, T., Lerro, C., Fedewa, S., et al. (2012). Cancer treatment and survivorship statistics, 2012. CA Cancer J Clin 62, 220-241.
Someya, S., Yu, W., Hallows, W.C., Xu, J., Vann, J.M., Leeuwenburgh, C., Tanokura, M., Denu, J.M., and Prolla, T.A. (2010). Sirt3 mediates reduction of oxidative damage and prevention of age-related hearing loss under caloric restriction. Cell 143, 802-812.
Spitz, D.R., Azzam, E.I., Li, J.J., and Gius, D. (2004). Metabolic oxidation/reduction reactions and cellular responses to ionizing radiation: a unifying concept in stress response biology. Cancer metastasis reviews 23, 311-
do not necessarily reflect the views of UKDiss.com.
Acquisition and Transmission of Basic Environmental Factors for Agriculture using Internet-of-Things Concept
Abstract
Economy of Saskatchewan mostly dependent on agriculture and it is considered as bread basket of Canada and the World. Saskatchewan is a prairie province and it has total area of 651,900 square kilometers and a population of 1114170[1]. The population density in Saskatchewan is 1.8 person per square kilometer which is very low. Saskatchewan economy is mainly dependent on agriculture. Agricultural crops are mostly dependent on basic parameters to yield the maximum output. These parameters can vary from crop to crop but basic parameters that are vital in agriculture are temperature [2], humidity, sunlight intensity, and wind speed. Taking care of each crop on a daily basis for farmers is nearly impossible considering vast lands of Saskatchewan. So the purpose of this project is to make the agricultural practices easier for farmers. To achieve this goal numerous factors and devices have to be analyzed to find the optimum solution by considering cost and energy efficient devices. By this project it is accomplished to make these parameters accessible on the internet which can be accessed via internet browser and on cellphone app. So in odd conditions, immediate attention can be given. This lies under the concept of Internet of things, which is defined as a connection between devices that can be controlled and communicate with each other over internet [4].
Table of contents
ABSTRACT…………………………………………………….2
List of figures…………………………………………………..5
List of tables…………………………………………………..6
CHAPTER 1…………………………………………………….7
Introduction
CHAPTER 2…………………………………………………..10
Review of devices Used
2.1 Raspberry pi………………………………………………10
2.2 Xbee pro…………………………………………………13
2.3 Arduino mega 2560…………………………………………18
2.4 Relay module……………………………………………..21
2.5 USB WI-FI hotspot…………………………………………..21
2.6 USB WI-FI adapter………………………………………….22
Chapter 3…………………………………………………….23
Hardware
Chapter 4…………………………………………………….27
Software
4.1 Raspberry pi………………………………………………27
4.1.1 How to setup raspberry pi………………………………….27
4.1.2 Setup SD Card…………………………………………..27
4.1.3 Serial Port configuration…………………………………..29
4.2 Xbee Pro…………………………………………………33
4.3 Arduino Mega 2560…………………………………………38
Chapter 5…………………………………………………….41
Coding
5.1 Arduino Mega 2560………………………………………..41
5.2 Raspberry pi………………………………………………43
5.2.1 Android app……………………………………………48
5.2.2 Raspberry pi auto login……………………………………53
5.2.3 Executing python script in start……………………………..55
Chapter 6…………………………………………………….57
Results
6.1 Cost……………………………………………………58
6.2 Power consumption…………………………………………59
6.2.1 Raspberry pi……………………………………………59
6.2.2 Xbee pro………………………………………………60
6.2.3 Arduino Mega 2560………………………………………60
6.2.4 HUAWEI LTE E8372 Hotspot stick…………………………….60
Chapter 7…………………………………………………….61
Conclusions and Future work
Appendix…………………………………………………….63
References…………………………………………………..68
List of figures
Figure 1.1 Overview of system……………………………….9
Figure 2.1 Raspberry pi…………………………………..11
Figure 2.2 Raspberry pi pin configuration……………………….11
Figure 2.3 GPIO ……………………………………….12
Figure 2.4 Xbee pro……………………………………..14
Figure 2.5 Xbee data flow…………………………………16
Figure 2.6 Data frame……………………………………17
Figure 2.7 Frame structure………………………………..18
Figure 2.8 Xbee pro……………………………………..18
Figure 2.9 Pin configuration………………………………..20
Figure 2.10 Turbo stick…………………………………..21
Figure 2.11 Wi-Fi adapter…………………………………22
Figure 3.1 RTU………………………………………..23
Figure 3.2 Data flow…………………………………….24
Figure 3.3 MTU………………………………………..25
Figure 3.4 MTU-Raspberry pi connection………………………..25
Figure 3.5 Arduino-Relay connection………………………….26
Figure 4.1 Raspberry pi GUI…………………………………29
Figure 4.2 Serial port initialization……………………………..30
Figure 4.3 cmdline.txt edit………………………………….31
Figure 4.4 XCTU………………………………………..33
Figure 4.5 XCTU settings…………………………………..34
Figure 4.6 XCTU settings…………………………………..34
Figure 4.7 XCTU settings…………………………………..35
Figure 4.8 XCTU settings…………………………………..35
Figure 4.9 Arduino environment………………………………39
Figure 4.10 Processor selection……………………………….39
Figure 4.11 Arduino environment………………………………40
Figure 5.1 Arduino environment………………………………41
Figure 5.2 Python……………………………………….44
Figure 5.3 Python shell…………………………………….45
Figure 5.4 New window……………………………………45
Figure 5.5 Data sparkfun…………………………………..47
Figure 5.6 Android app……………………………………49
Figure 5.7 App making…………………………………….49
Figure 5.8……………………………………………50
Figure 5.9……………………………………………50
Figure 5.10…………………………………………..51
Figure 5.11…………………………………………..51
Figure 5.12…………………………………………..52
Figure 5.13…………………………………………..52
Figure 5.14…………………………………………..53
Figure 5.15…………………………………………..53
Figure 5.16…………………………………………..54
Figure 6.1 Data…………………………………………57
Figure 6.2 Data on app…………………………………….58
Figure 6.3 Xbee………………………………………..60
List of tables
Table 2.1-Technical specification…………………………….13
Table 2.2-Pin configuration of Xbee……………………………14
Table 2.3-Technical specifications……………………………19
CHAPTER 1
INTRODUCTION
Agriculture in Saskatchewan has a role of back bone in the economy and GDP of the province. Saskatchewan has led the world many times in wheat production and it is one of the biggest producer of canola in the region. Before dipping in to the engineering aspects of this project, there is a need to understand the significance of the agricultural parameters, and how much the output of crop depends on these parameters. The essential parameters for every crop are
- Temperature
- Humidity
- Water level
- Sun light intensity
- Wind speed
The outputs of all the crops are dependent on these parameters. Crop dependency on these parameters varies i.e. some parameters are more crucial to some crops and some are less. But each parameter plays their part in crop output. For example the wheat plant can be killed if excessive water stays in soil for almost three days. Crop yield losses because of water deficit exceeds all other factors combined [3]. Moreover, the serious damage to the tissues of plant can be caused if soil is excessively dry in a single day. Good farming demands to take care of environmental factors by monitoring them well and respond in case of any odd conditions.
For this purpose the challenge was to introduce a standalone system that can be powered by renewable energy resources. In this project, solar panels have been used. This makes the whole unit power efficient so it may never run out of power without compromising on integral goals. In my part of this project, I have accomplished the communication of temperature and humidity and made the whole unit power efficient. Rest of the parameters can be added in the future work. Raspberry pi is used to upload the data onto the internet server and Arduino microcontroller is used as a primary device which controls all the data and turning on & off the Raspberry pi. Xbee pro kit has been used to transmit and receive the data wirelessly from remote location to main location. Wireless USB device has been used to provide internet access. The data from the fields will be collected via different sensors which is then passed on to Xbee pro RTU(Remote Terminal Unit) which transmits the data wirelessly to MTU (Main terminal Unit) of Xbee pro kit after selected intervals of time. Arduino receives this signal from Xbee pro serially and turn on the USB Wi-Fi device and raspberry pi. After Raspberry pi turns on, this data is then uploaded to the internet servers automatically. After uploading the data, the raspberry pro turned off automatically and the system then goes back to hibernation state. The data uploaded on the servers can be accessed through internet browser. With the recent advancement in mobile communication and smart phones, users are more inclined towards the usage of mobile apps so the data have made accessible through android app as well.
By considering a lot of different options of devices that can serve the purpose, aforementioned devices has been selected because of their less cost and their durability. Through programming, these devices have been made to work with higher energy efficiency. The general working of the system has been shown in Figure 1.1.

Chapter 2
Review of devices used
This chapter will cover the details of the devices that have been used in this project. Their role in the project and their significance over other competitive devices are discussed.
Following are the devices that have been used in this project
- Raspberry pi
- Arduino mega
- Xbee pro
- Relays kit
- TP link USB adapter
- TP link bell USB WI-FI router
2.1 Raspberry pi
Raspberry pi is office card sized computer which can operate Linux operating system. This device has brought a new era in engineering world. This device is capable of connecting with Led monitors or with TV for display just like regular computers. It can be connected with mouse and key board through USB ports and it has the ability to connect with Wi-Fi internet via Wi-Fi USB adapter. Like a regular computer, one can use this device for making spread sheets, Internet browsing, playing videos or video games. Besides all of the capabilities discussed earlier, the main significance of this device is that it has GPIO pins just like ordinary microcontrollers that can be programmed. This brings endless options to implement different kind of projects. I/O ports of raspberry pi has been shown in Figure 2.1 and Figure 2.2.

Figure 2.1 Raspberry pi

Figure 2.2 Raspberry pi pin configuration
Raspberry pi does not have any internal storage option, so it has SD card slot for storage purpose. Operating system of raspberry pi is installed in the SD card which is discussed step by step later on in this report. This device has two USB 2.0 ports for accessories connectivity, HDMI port for visual interface but this device does not have VGA port. Raspberry pi can be connected with Internet, through Ethernet cable and it has standard RJ45 connector port and via USB Wi-Fi adapter. Taking into account that it has only two USB ports, if more devices need to be connected with raspberry pi then USB hub can be interfaced. Besides that it has audio jack and video rca socket. Micro USB socket is used to power up the Raspberry pi. Moreover, it has 40 GPIO pins. Out of them some are I/O, VCC 5V, 3.3 V and serial communication pins as shown in Figure 2.3 these pins have been discussed in detail later in the report.

Figure 2.3 GPIO
2.2 Xbee Pro
Xbee pro RF modules are designed to provide low cost low power wireless networks. Xbee devices use less power and they are very durable in the delivery of data between the devices wirelessly. Xbee Pro works within the SRD 868 MHz frequency band .Main terminal unit of Xbee pro has been shown in Figure 2.4.
Technical specifications of Xbee pro are in following table.
Table 2.1-Technical specification
Indoor/Urban range Up to 1800 ft Outdoor RF line of sight range Up to 25 miles with 2 dB dipole antenna Power output transmission 85-500 mA, can be adjusted by power levels RF data rate 24 kb/s Data throughput 2.4 kb/s UART 3.3 V CMOS(5V tolerant) Data rate 1200-230400bps Supply voltage 3.0 to 3.6 VDC Operating current 500-800 mA Sleep current 55μA 
Figure 2.4 Xbee pro
The pin configuration and their details are tabled below.
Table 2.2-Pin configuration of Xbee
Pin# Name Direction Description 1 Vcc – Power supply 2 DOUT Output UART data out 3 DIN/ CONFIG Input UART data in 4 DIO12 Either Digital I/O 12 5 RESET Input/ open drain output Module reset 6 PWM0/ RSSI /DIO10 Either PWM output 0/Rx signal strength indicator/digital IO 7 PWM/DIO11 Either PWM Output 1/digital I/O 11 8 – – – 9 DTR / SLEEP_RQ/ DIO8 Pin sleep control line or digital IO 8 10 GND – Ground 11 AD4/DIO4 – Analog input 4 / digital I/O 4 12 CTS / DIO 7 – Clear to send flow control / digital I/O 7 13 ON/SLEEP OUTPUT Module status indicator or digital I/O 9 14 VREF – 2.6 V – Vcc 15 Associate /DIO5/AD5 – Associated indicator, digital I/O 5 16 RTS/DIO6 – Request to send flow control/ digital I/O 6 17 AD3/DIO6 – Analog input 3 / digital I/O 3 18 AD2/DIO2 – Analog input 2 / digital I/O 2 19 AD1 /DIO1 – Analog input 1/ digital I/O 1 20 AD0/ DIO0 / Commissioning button – Analog input 0, digital I/o 0, or commissioning button. Serial communication
The Xbee pro connects to the Arduino microcontroller through asynchronous serial port. Arduino and Xbee pro can communicate at different UART.
UART
UART is abbreviated for Universal Asynchronous Receiver /Transmitter. So, the devices which support UART can be directly connected with Xbee pro for serial communication. Figure 2.5 shows how data flows between devices under UART.

Figure 2.5 Xbee data flow
The data flows in to Xbee module from microcontroller onto pin 3 DIN as an asynchronous serial signal. The data bytes have its first bit low and stop bit high. Each byte has 8 data bits and transmitted with least significant bit first as shown in Figure 2.6.

Figure 2.6 Data frame
From figure 2.6, 1 byte has been elaborated with respect to bits. The byte starts with start bit which is low and it ends at logic high, the last bit called as stop bit. UART controls the timing parity, checking this is vital for communication. UART configuration on both ends of the devices has to be same to make serial communication successful. UART includes baud rate, data bits, stop bits, start bits, and parity.
API frame
Xbee transmit its data in the form of API frame. It is very secure than ordinary data transmission. It supports two type of API frames but I am using AP=1 API operation
API (AP = 1)
To activate this mode of API we have to select AP= 1 and the data frame structure is shown in Figure 2.7

Figure 2.7 Frame structure
Data will be discarded before the start delimiter byte. In case of data disruption, the Xbee pro mentions the failure status.
2.3 Arduino Mega 2560
Arduino Mega 2560 is a microcontroller board which has ATmega 2560 microcontroller installed on it. The board has 54 Digital input/output pins, out of which 14 can be used for PWM output, and 16 as analog input pins. The most beneficial characteristic of Arduino mega 2560 is that it can supports 4 UART ports simultaneously. The board comes with 16MHz crystal oscillator and a USB connection. To power up it has power jack on the side of the board. It has ICSP header and a reset button. An overview of Xbee pro has been shown in Figure 2.8.

Figure 2.8 Xbee pro
Technical details of Arduino mega 2560 are tabled below.
Table 2.3-Technical specifications
Microcontroller type ATmega 2560 Operating Voltage 5V Input voltage (Optimum) 7-12V Input Voltage(range) 6-20V Digital I/O Pins 54 Analog Input pins 16 DC current per I/O pin 40 mA DC current for 3.3 V pin 50 mA Flash Memory 256 kb SRAM 8 kb EEPROM 4 kb Clock speed 16 MHz Arduino can be powered through USB port or with external power supply, Arduino selects power source automatically. In case of external power supply, the Voltage should be between 6 to 20 V but the recommended input voltage level is between 7 and 12 V. In case of 6 V as input the 5V pin may not provide 5V on the board and functions of Arduino would be unstable. Whereas, if supplied with more than 12 V, voltage regulator may heat up and cause damage to board so it is recommended to use 7-12 V.
Arduino mega use ATmega 2560 microcontroller which has 256 kb of flash memory to store the code. It has 8 KB SRAM and 4 KB of EEPROM. It also has 54 pins and they can be programmed to be used as INPUT or OUTPUT pins. It has 4 Serial pins
Serial0= pin 0(RX) & 1 for (TX), Serial 1= pin 19 for (RX) & 18 (TX), Serial 2= pin 17 for (RX) & 16 for (TX), Serial 3= pin 15 for (RX) & 14 for (TX). These pins can be used to communicate with other devices serially. Arduino has a capacity to use all 4 serials at a time. It has LED on board which shows the digital logic status of pin 13, when pin is high the light will turn on and it remains off at logic low. It has analog pins with which analog voltage output sensors or modules can be interfaced. It has polyfuse, which means if more than 500 mA current try to pass through the Arduino from computer the fuse will break the connection. Pin configuration has been shown in Figure 2.9.

Figure 2.9 Pin configuration
2.4 Relay module
To turn on the raspberry pi and Hotspot stick relay module has been used. This relay module will provide the path between source and raspberry, as well as with WI-FI Hotspot stick at Logic low.
2.5 USB WI-FI Hotspot
HUAWEI LTE E8372 Hotspot Turbo Stick
To provide internet connectivity in a remote location 4G LTE HUAWEI hotspot stick has been used. It is provided by the BELL networks in Canada, its speed can soar up to 150 Mbps. When powered, it acts like a Wi-Fi hotspot. 10 devices can be connected with this device wirelessly, similar to standard router. Similarly some other Hotspot sticks are also available in market but they are not as handy as this and in addition to that the power consumption of those devices are higher as compared to this one.

Figure 2.10 Turbo stick
2.6 USB WI-FI adapter
To connect raspberry pi to internet, two options can be approached, one through Ethernet port and the other through USB WI-FI adapter. In this project, USB WI-FI adapter TPLINK TL-WN725N has been used. This adapter will connect to USB hotspot stick wirelessly and provide a path to access internet servers.

Figure 2.11 Wi-Fi adapter
Chapter 3
Hardware
In this chapter, hardware of the project has been elaborated. Hardware is the physical part of the project, hardware of all the devices that has been used in this project and their interconnections has been explained as follows
RTU MODULE
This Xbee Pro module is called as RTU (Remote Terminal Unit) as shown in Figure 3.1.

Figure 3.1 RTU
This module sits in a field and transmits the data to MTU (Main terminal Unit) wirelessly. This RTU has capability to connect with Omni directional antenna which enhance its range. RTU is interfaced with sensors through microcontroller which sends their output to RTU. RTU converts this data into API frame and transmits it as shown in Figure 3.2.

MTU
RTU
Figure 3.2 Data flow
MTU MODULE
On the other side, MTU is connected with Arduino mega. MTU receives the signal from RTU module wirelessly and send that data through serial port on to the Arduino microcontroller. The TX pin of the Xbee pro is connected with the RX1 pin on Arduino board and TX1 pin of Arduino is connected with RX pin of Xbee pro. To make serial communication accurate ground pins of both devices should be connected with each other [5].
Arduino is connected with raspberry pi through serial communication ports, the TXD pin of raspberry is connected with RX3 of Arduino and TX3 pin of Arduino is connected with the RXD pin of raspberry pi as shown in Figure 3.4.

Figure 3.3 MTU

Figure 3.4 MTU-Raspberry pi connection
Arduino powers up the Raspberry pi and USB Hotspot device through a relay kit. The relay kit is connected with Arduino through output declared pin 13 as shown in Figure 3.5. The relay kit will be powered through external source.

Figure 3.5 Arduino-Relay connection
To make this project power efficient this relay module has been used. Arduino will provide the logic high at its 13 output which provides switching in the relay module. This relay module is powered by external power supply so when relay switch their state, it completes the path between external power supply and raspberry pi, Wi-Fi hot spot device. The reason to use external power supply for raspberry pi and Wi-Fi hotspot device is that the output power capacity of Arduino is not high enough to power up these devices. So an indirect method has been adopted to achieve the purpose.
Chapter 4
Software
4.1 Raspberry pi
4.1.1 How to setup raspberry pi
Raspberry pi is a small computer but unlike regular computer it need little extra accessories to make it work.
- USB key board and mouse
- HDMI cable to connect with monitor for display
- Power cable(Micro USB) to power up the raspberry pi
- SD card. Raspberry pi operating system installed in the SD card. Without this pi will not work.
- Ethernet cable will be required to connect pi with internet
- USB Wi-Fi adapter to access internet wirelessly
4.1.2 Setup SD Card
To install an operating system into SD card few steps have to be followed. First we have to select card of storage capacity enough to accommodate the Linux system. So recommended storage capacity is 8 GB and higher. SD card should be formatted first then the latest version of Raspbian have to be installed. Raspbian is available on the website of raspberry pi under NOOBS section.
Procedure is explained in steps below:
- Download the latest Raspbian version from Raspberry pi official website, It is in .zip format, unzip the .zip file to any folder.
- Download Win32DiskImager, unzip the .exe file and install it.
- Insert the SD card into the SD card reader slot, SD card will be detected automatically, if it doesn’t, go to control panel then add SD card in add /remove device.
- Format the SD card.
- Open the Win32Diskimager and select the SD card if it’s not selected automatically Under Device tab. Now select the small folder icon just beside the device tab and browse the Raspbian .img file which was unzipped before. Select the write option, and it will began Burning image onto SD card, this may take some minutes.
Now Insert this SD card into SD card slot in Raspberry pi and connect HDMI cable in the HDMI slot for display and wireless mouse keyboard adapter in USB port. To access Wi-Fi wirelessly insert Wi-Fi adapter in USB slot, and power cable to power the Raspberry pi.
Once power turned on Raspberry pi will start booting. For the first time Raspberry will ask some settings to select once it reaches Raspi-config window. There would be a long list of settings but one have to select only expand_rootfs and Enter. After that select Finish option and press yes for reboot.
Rebooting will take some moment, after raspberry complete its reboot it will ask for Username and password.
By default
Username: Pi
Password: Raspberry
Then type startx in a command line to proceed towards the Linux Raspberry pi GUI. GUI is shown in Figure 4.1.

Figure 4.1 Raspberry pi GUI
4.1.3 Serial Port configuration
Raspberry pi will receive and transmit all the data through serial ports via serial communication. Raspberry pi has only one serial port, which by default cannot be accessed. To make serial port working, certain settings needs to be done. First we have to disable the console login so that it can be used for Project purpose.
First file that needs to be edited is inittab, it can be found under the directory/etc/inittab.
Remember it can only be edited in the Lxterminal or using console. It’s always recommended to login as SuperUser to make these changes.
One can login as SuperUser by typing Sudo su in command.
The inittab file contains the command that needs to be disabled to make serial port work for project. File will look like as shown in figure 4.2.

Figure 4.2 Serial port initialization
Last line is a command that needs to be disabled. It can be disabled by removing all the text written in it or it can be disabled by making it as comment which can be achieved by adding # in the start of line as shown [6].

After editing, save the file and reboot the raspberry pi through a command [6] sudo shutdown –r now.
Second file that needs to be edited is cmdline.txt. The directory of this file is /boot/cmdline.txt
The file will look like as shown in figure 4.3.

Figure 4.3 cmdline.txt edit
The command needs to be edited to make serial port work. Before edit, the command will look like the following:
dwc_otg.lpm_enable=0 console=ttyAMA0,115200 kgdboc=ttyAMA0,115200 console=tty1 root=/dev/mmcblk0p2 rootfstype=ext4 elevator=deadline rootwait
The colored part should be removed from the command. After removing the colored part the command will look like the following:
dwc_otg.lpm_enable=0 console=tty1 root=/dev/mmcblk0p2 rootfstype=ext4 elevator=deadline rootwait.
Save the file and reboot the device by command sudo shutdown –r now.
The device is now ready to communicate serially. To verify that serial port is working properly, one easy test can be performed. Connect TXD pin with RXD pin. Minicom is the tool used for this and it can be downloaded by the following command sudo apt-get install minicom. After downloading, initiate the serial port by the command minicom -b 9600 -o -D /dev/ttyAMA0
If letters are echoing after typing, it implies that serial port is working at 9600 baud rate. If it’s not echoing check the wire connections [7][8][9].
4.2 XBEE PRO
Xbee pro settings can be configured by XCTU software. The software can be downloaded using the following link:
https://www.digi.com/products/xbee-rf-solutions/xctu-software/xctu
After downloading and installing the XCTU software, window will open up as shown in Figure 4.4.

Figure 4.4 XCTU
Now select the Discover module icon as shown in Figure 4.5.

Figure 4.5 XCTU settings
Following window will appear, select the right COM port at which Xbee pro is connected as shown in Figure4.6.

Figure 4.6 XCTU settings
Check the right settings to discover the module as shown in Figure 4.7, if not sure about the settings select all.

Figure 4.7 XCTU settings
The device will be discovered as shown in Figure 4.8, select the Add selected device option. If device is not detected press reset button on Xbee pro or troubleshoot the connected USB port.

Figure 4.8 XCTU settings
Now select the radio module connected option to search for RTU radio terminal of Xbee pro. After searching it will appear in the tab.
Following are the settings of Xbee pro that needs to be configured.





For cyclic sleep mode set SM=4 and ST needs to be configured accordingly.
4.3 ARDUINO MEGA 2560
Arduino microcontroller settings are not complex. Arduino programming software can be downloaded from the following website:
https://www.arduino.cc/en/Main/Software
After installation, go to Tools tab and select the board as shown in Figure 4.9. After selecting the right board select the Processor as shown in Figure 4.10. After selecting the correct board and the processor the programming environment will be created as show in Figure 4.11.

Figure 4.9 Arduino environment

Figure 4.10 Processor selection

Figure 4.11 Arduino environment
At this point, Arduino is ready to use.
Chapter 5
Coding
After setting up the hardware and the software of devices now its turn for coding.
5.1 ARDUINO MEGA 2560
Arduino supports C/C++ language programming. C/C++ language is very popular in microcontroller programming software. The task of Arduino in this project is to make the whole unit power efficient. After the installation and settings of Arduino software the coding window will appear as shown in Figure 5.1.

Figure 5.1 Arduino environment
It starts with two basic functions Void setup and Void loop. Void setup will execute only at the start of program for once or when Arduino gets reset, inside the bracket all the pins and ports have to Initiated which will be used in Void loop section. Whereas Void loop is a forever loop, it keeps on executing until Arduino get reset. The main purpose of the Arduino Mega 2560 is to make the whole unit power efficient which has been achieved by the coding. Arduino receives the data from Xbee. The Arduino keeps on checking the data availability on its serial port if it receives the data it turns on the raspberry pi by and USB WI-FI module connected through same relay module beside storing data using For loop in array. Arduino waits for raspberry pi to boot and then it pass the data to raspberry pi, raspberry pi process the data and upload it to the internet server. After uploading the data, Raspberry pi gives logic 1 signal at Pin 7 of Arduino and raspberry pi turn off by itself which explained later in this chapter and Arduino removes the power from pin 13 which disable Relay module. Then Arduino will again look for data at the input of serial port 1 and this process keep on repeating. The process has been shown in block diagram.

Block diagram
Coding file has been shown in Appendix.
5.2 Raspberry pi
Raspberry pi has Linux operating system and it works same as ordinary computers but it has additional 40 pins which makes it the best choice to integrate thousands of projects. Its pin acts the same way as microcontroller pins which enable it to interface with sensors and other devices. Moreover it supports the communication with other devices through serial port. This device is combination of microcontroller and computer.
Raspberry pi supports Python language for coding. Python language is simple and it is one of the most implemented language in coding world. Python 2 is a software in which coding has been implemented.

Figure 5.2 Python
Select the menu and programming then open up the Python 2 as shown in Figure 5.2.

Figure 5.3 Python shell
Python shell will appear as shown in Figure 5.3, select File and the New Window to make script file for coding as shown in Figure 5.4.

Figure 5.4 New window

Occupational Health and Safety Issues in Agriculture
Contents
Section 2 Vehicles and Machinery
2.2 All-Terrain Vehicle (ATV) / Quad Bike
2.3 Machinery and power take off (PTO)
Section 4 Work Related Musculoskeletal Disorders (MSDs)
4.2 Theories of Musculoskeletal Injury Causation
4.2.1 Multivariate Interaction Theory
4.2.2 Differential Fatigue Theory
4.4 Risk Factors in Agriculture
Section 5 Higher Risk Categories
6.3. Potential Outcome of Stress – Depression and Suicide
Section 7 Accident Prevention Strategies
7.1 Occupational Health and Safety Legislation
7.2 Health and Safety Authority (HSA)
7.3 Farm Safety Partnership Advisory Committee
Agriculture — a hazardous industry
Section 1 Introduction
The Oxford English Dictionary defines agriculture as the science, occupation or practice of farming, including cultivation of the soil for the growing of crops and the rearing of animals to provide food, wool, and other products (“agriculture, n.”, 2018).
In Ireland, the agriculture sector has one of the highest rates of work-related injuries and fatalities even though only a small proportion of the workforce is employed there. In 2016 almost 73 percent of work related fatalities occurred in the sector. The rate of fatality was ten times higher than in all sectors, with agriculture at 21.3 per 100,000 workers and all sectors being 2.1 per 100,000 workers (Health and Safety Authority, 2017a). The Census 2016 found that agriculture accounted for only 4.6 percent of total employment, it also found the majority of farmers were self-employed (Government of Ireland, 2017). The causes of all fatal accidents in agriculture in Ireland 2006 – 2015 are shown in chart in Figure 1.

Figure 1 Causes of fatal accidents in agriculture in Ireland (2006-2015) (Health and Safety Authority, 2017b)
The Health and Safety Executive in Great Britain also report high rates of injury and fatalities in this sector, the worker fatality rate was 7.61 per 100,000 workers in 2016/17. This equates to around six times that in construction and 18 times that for all sectors (Health and Safety Executive, 2017). In 2014 14.3 percent of fatal accidents and 5.4 percent of non-fatal accidents at work in the EU-28, occurred in the agriculture, forestry and fishing sector (Eurostat, 2018).
This literature review is focused on the topics of vehicles and machinery, livestock, work related musculoskeletal disorders, groups that are in the higher risk categories on farms, stress and accident prevention strategies in agriculture.
Section 2 Vehicles and Machinery
Agriculture is dependent on the use of tractors, farm vehicles and machinery. They allow farmers to work with less effort, more efficiently and improved productivity. Statistics from the Health and Safety Authority (HSA) demonstration that for the period 2006 to 2015, there were 194 fatalities in the agricultural sector in Ireland, 29 percent of these were caused by tractors and farm vehicles and 19 percent by machinery (Health and Safety Authority, 2017b).
2.1 Tractors
In years gone by, most tractor fatalities worldwide were due to overturning (Day, 1999) (Pacific Northwest Agricultural Safety and Health Center, 2004) (Horsburgh, et al., 2001). Tractor overturn fatality rates are dropping due to increases in the use of rollover protection structures (ROPS). ROPS can be of various designs, they are roll bars or cabs provided to establish a protective zone for the tractor operator in the event of a tractor overturn. The tractor operator must also wear a seatbelt to keep them inside the protective zone during an overturn. When properly used ROPS can prevent almost all agricultural tractor rollover fatalities (Ayers, et al., 2018).
In Sweden the occurrence of fatal rollovers per 100 000 tractors per year was reduced from 17 to 0.3 after regulations were introduced requiring ROPS. There were also reductions in Norway, Finland, West Germany and New Zealand due to the introduction of similar regulations (Springfeldt, 1996).
Being run over, hit or crushed by a tractor is also a frequent cause of death in agriculture (Rorat, et al., 2015). 79% of all deaths involving vehicles and farm machinery in Ireland between 20006 – 2015 were from being crushed (67%) or struck (12%) as seen in Figure 2. Poor planning, operator error, lack of training and inadequate maintenance of the vehicle or machine and poor operation of vehicles particularly when reversing was the main cause of these fatalities (Health and Safety Authority, 2017b).

Figure 2 Causes of fatal accidents involving tractors and vehicles (2006- 2015) (Health and Safety Authority, 2017b)
2.2 All-Terrain Vehicle (ATV) / Quad Bike
There is increasing unease in many countries regarding the number of serious injuries and fatalities related to ATVs /quad bikes. An ATV/ quad bike is defined as a vehicle with low-pressure tires, a straddle seat and handlebars for steering. A fatality is more likely to occur when an ATV rolls over or pins a driver underneath. Fatalities are also linked with injuries to the head, neck and chest (Shulruf & Balemi, 2010) (Grzebieta, et al., 2015) (Transport and Road Safety (TARS), 2017). The use of a helmet significantly decreases the likelihood of injury or fatality associated with ATV-related crashes (Bowman, et al., 2009).
In Ireland In the past 10 years (2008-2017) there were 12 quad bike fatalities. Although ROPS are available for quad bikes the Health and Safety Authority has not issued an instruction or recommendation in relation to the use of ROPS as they do not have sufficient information on its effectiveness (Health and Safety Authority, 2018a).
2.2.1 Further Research
Further research is required on the effectiveness of ROPS on quad bikes in Ireland.
2.3 Machinery and power take off (PTO)
PTO entanglement causes 11% of all fatal machinery accidents and many serious injuries. Most PTO accidents occur when clothing, hair and/or limbs are entangled in the rotating PTO shaft. Most of these accidents would be prevented with the use of a guard. In Ireland all PTO guards should comply with European Standard EN 12965 and bear the CE mark (Health and Safety Authority, 2017b). A recent study of farms in New York found that PTO guards were missing off 57% of PTO driveline implements (Sorensen, et al., 2017).
Section 3 Livestock
3.1 Handling and facilities
Animal encounters are a prominent cause of injuries and fatalities in the agriculture sector (Health and Safety Authority, 2017a) (Health and Safety Executive, 2017). Many cases involve large farm animals butting or kicking workers. Kicks to the head and chest result in more instantaneously fatalities, this is possibly due to the effects of direct trauma to the brain, heart, or lungs (Bury, et al., 2012).
Animal behaviour is often unpredictable. Animals that are usually docile can become agitated in certain situations, an example of this is shown in a Swedish study of dairy cows. The study looked at the amount of potentially dangerous incidents and risk situations when moving cows to be milked compared to moving them to have hoof trimming carried out. It found that a significantly higher amount of potentially dangerous incidents and risk situations occurred when moving cows to hoof trimming compared to milking (Lindahl, et al., 2016).
The risk of injury from an animal encounter is also increased when it involves animals that have not been handled frequently or newly calved cows, this can occur when animals being moved, separated or released. Proper livestock handling systems are important to ensure calm animals and a safe work environment for farm workers. Many accidents involving cattle could be avoided with better handling facilities (Health and Safety Executive, 2012).
Handling facilities should include a crush or race suitable for the cattle that will be handled. A crush/ race should allow most straightforward chores to be carried out safely. They should have adequate light, be easily accessible and have an emergency escape or slip gates for staff (Health and Safety Authority, 2010b)
3.2 Zoonotic Disease
Zoonotic disease or zoonoses or zoonosis are diseases and infections which are transmittable between animals and people. They include a wide variety of disease types including parasitic, fungal, bacterial and viral. They can cause illness by infecting the body when they are inhaled, swallowed, absorbed through the eyes or when they penetrate the skin through small cuts or grazes. In the UK in the agriculture sector about 20,000 people per year are affected by zoonoses (Health and Safety Executive, 2017).
In Ireland 20 zoonosis are known to exist these include brucellosis, tuberculosis, tetanus, leptospirosis (from rats or cattle urine), escherichia coli O157, ringworm, orf and toxoplasmosis (Health and Safety Authority, 2017b). Mahon, et al., (2017) found concerning the level of Irish farmers’ knowledge and awareness of the spread of infection from animals to humans (Mahon, et al., 2017).
3.2.1 Control Measures
Control measures should be put in place to prevent the spread of infections. Theses should include: avoiding or, if not possible, reducing contact with animals; maintaining a healthy herd; vaccinating; covering all wounds, cuts and scratches; immunising (for example, against tetanus); using protective equipment (for example, gloves, aprons); and maintaining good personal hygiene (Health and Safety Authority, 2017b).
3.2.2 Further Research
A lot of the focus on zoonotic disease research is related to food safety and public health, no Irish research exists on the prevalence of zoonotic diseases as a result of occupational exposure in agriculture. International research mostly relates to veterinary surgeons.
Section 4 Work Related Musculoskeletal Disorders (MSDs)
4.1 Definition and Effects
MSDs are a group of disorders affecting the musculoskeletal system and can present in the tendons, muscles, joints, blood vessels and/or nerves of the limbs and back (National Institute for Occupational Safety and Health, 1997). Symptoms can include pain, discomfort, numbness and tingling in the affected area and can range in severity from mild to severe, they can also be periodic, chronic or debilitating (Health and Safety Authority, 2013). MSDs especially lower back pain often results in work disability requiring farmers to take time off work, to change work habits and to get help on the farm (Osborne, et al., 2013).
4.2 Theories of Musculoskeletal Injury Causation
Four theories exist to explain the causes of MSDs, all centre around the assumption that MSDs are biomechanical in nature. They can all occur at the same time and interact with each other and each MSD can be a combination of them.
4.2.1 Multivariate Interaction Theory
Injury to the musculoskeletal system is due to individual components and their mechanical properties. These components can be affected by individual’s physical characteristics, size, shape, and structure and by their psychosocial makeup. They can also be affect by the type of biomechanical hazards in their occupation.
4.2.2 Differential Fatigue Theory
Unbalanced occupational activities create different fatigue and in doing so an imbalance in body movement resulting in injury.
4.2.3 Cumulative Load Theory
This theory suggests that each component of the musculoskeletal system has a threshold range of load and repetition. Wear and tear causes deterioration of the component, each component has a limited life and after this an injury occurs.
4.2.4 Overexertion Theory
This theory is based on when excessive physical effort surpasses the tolerance limit of the musculoskeletal system or its components. Force, duration, posture and motion interact to cause occupational musculoskeletal injury (Kumar, 2001).
4.3 Prevalence
Russell, et al., (2015) found that between 2001 and 2012 the highest injury rates were in the agriculture sector, of those musculoskeletal disorders were the most common form. Between 2002 and 2014 musculoskeletal disorders accounted for 63 percent of all injuries recorded and agriculture workers were 2.2 times as likely to experience one as in all sectors combined (Kenny, et al., 2018) (Russell, et al., 2015) (Russell, et al., 2016) (Osborne, et al., 2012).
In a 2010 published study of 600 Irish farmers, 56% had experienced a MSD in the previous year. MSDs included: back pain (37%); neck/shoulder pain (25%); knee pain (9%), hand–wrist–elbow pain (9%), ankle/foot pain (9%) and hip pain (8%) (Osborne, et al., 2010). This reiterated the findings of a 2009 study which showed there was a high prevalence of lower back pain felt by Irish Farmers (O’Sullivan, et al., 2009).In 2006 a study in Kansas also found 60% of farmers reported an MSD symptom in the previous year (Rosecrance, et al., 2006).
4.4 Risk Factors in Agriculture
Musculoskeletal disorders are a major cause of pain and incapacity among working adults. Working in jobs where ergonomic conditions are poor may lead to the development of musculoskeletal disorders (Madan & Grime, 2015). In agriculture the main risk factors are: lifting and carrying heavy loads; sustained or repeated full body bending (stoop); very highly repetitive work; excessive force; and very awkward posture during lifting activities; (Fathallah, 2010) (Health and Safety Authority, 2018b).
Additionally Osborne, et al., (2010) found that the number of hours worked by farmers makes them predisposed to MSDs. (Osborne, et al., 2010). Russell, et al., (2015) also found longer working hours are linked with a higher likelihood of both injury and illness (Russell, et al., 2015).
4.5 Control measures
Although it is difficult to control some of the hazards associated MSDs, improvements can be made. These should include: reducing load size; using attachments on tractors; improving seating in tractors; improving storage facilities; raising work platforms or benches; fitting wheels to heavy loads; using hitch three-point linkage systems (Health and Safety Authority, 2018b).
Section 5 Higher Risk Categories
5.1 Older Farmers
In Ireland around 30% of farms are operated by those aged 65 and over (Dillon, et al., 2015) (Dillon, et al., 2017). The average age of an Irish farmer is 57 years (Health and Safety Authority, Farm Safety Partnership, 2016). Older farmers are at a greater risk of having accidents, farmers aged 65 or more accounted for 35 percent of all farm fatalities between 2006 and 2015 see figure 3. Most of these deaths are thought to be associated with reduced speed of movement and reduced agility in the use of tractors and machinery; livestock handling and falls from heights see Figure 4 (Health and Safety Authority, 2017b).
Heaton, et al., (2012) found age-linked health problems may impact the aging farmer’s ability to respond to hazards and avoid injury. Farmers who had mobility problems were twice as likely to have an injury as those with out (Heaton, et al., 2012). Furthermore the chance of work-related illness increases with age (Russell, et al., 2015). Farmers who were older and had farmed over long hours, over a long period of time were more likely to suffer with hip problems (Osborne, et al., 2010).
Figure 3 Farming fatalities by age 2006- 2015 (Health and Safety Authority, 2017b)
Figure 4 Causes of fatal accidents in farmers 65 and over (2006-2015) (Health and Safety Authority, 2017b)
5.2 Children and Young People
Farms are an unusual place of work in so far as they often combine a family home and a hazardous workplace. Farming as well as being an occupation, is a way of life for most farmers, part of their identity. While parents are often aware of the hazardous environment, they choose to bring child on to a farm as they feel the benefits are greater than the risks (Elliot, et al., 2018). The Health and Safety Authority define a child as a person who is under 16 years of age or the school leaving age (whichever is the higher) and a young person as older than a child but under the age of 18 (Health and Safety Authority, 2010a).
Children and people aged under 18 suffered 12 percent of fatal farm accidents between 2006 and 2015 (Health and Safety Authority, 2017b). Watson, et al. (2017) suggested that younger farmers were more likely to take risks where risk taking was measured in terms of failing to routinely take safety precautions (Watson, et al., 2017). In Canada a study has shown risk taking behaviour is much higher in farm verses non-farm children. Farm adolescents partake more often in multiple risk-taking and it is this risk taking that is linked with incidences of serious injury in farms adolescents (Pickett, et al., 2017)
Section 6 Stress
6.1 Definition
Lazarus (1966) defined stress as a person/ environment relationship. Stress and emotion depend on how a person assesses their interactions with their environment and how they react. Stress arises when a person perceives that they cannot effectively cope with the demands being made on them or with threats to their well-being (Lazarus, 1966). Furthermore Lazarus and Folkman (1984) found ‘stress results from an imbalance between demands and resources’ (Lazarus & Folkman, 1984).
6.2 Causes of stress
Research into stress and stressors such as economic worry is conflicting. Glasscock, et al., (2006) suggest that higher levels of stress and poor safety behaviour were associated with an increased risk of injury (Glasscock, et al., 2006). Watson, et al., (2017) could find no firm relationship between risk taking and stress and found that in general, farmers reported low levels of distress (Watson, et al., 2017). In comparison Parry, et al., (2005) found a complicated web of factors make farming a particularly (or potentially) stressful occupation. The main causes of stress among farmers are: uncertainties due to markets, farm prices and farm policies; financial worries,excessively long working hours, poor working conditions, poor health and isolation (Parry, et al., 2005). Furey, et al., (2016) established farmers frequently work alone, for long periods, in difficult and often unpredictable conditions (Furey, et al., 2016).
6.3. Potential Outcome of Stress – Depression and Suicide
A study in the U.S.A. demonstrated that farming was among the highest occupations for rates of suicide. This study also suggested farmers may be at a higher risk of suicide due to job-related isolation and demands, stressful work environments, and work-home imbalance, as well as socioeconomic inequities, including lower income, lower education level, and lack of access to health services (McIntosh, et al., 2016). Furthermore Tiesman, et al. (2015) found that the issues that may contribute to the high rate include the potential for financial losses, chronic physical illness, social isolation, work–home imbalance, depression due to chronic pesticide exposure, and barriers and unwillingness to seek mental health treatment (Tiesman, et al., 2015).
Section 7 Accident Prevention Strategies
7.1 Occupational Health and Safety Legislation
In some areas of farming, legislation and regulation have been proven to reduce fatalities. An example of this was the regulations requiring ROPS (Springfeldt, 1996). Although there is no single European-level directive that explicitly deals with the safeguarding the health and safety of workers in all areas of agriculture, under Irish health and safety legislation farmers have similar duties to other employers (European Commission, 2012).
Farmers must produce a safety statement or comply with the terms of a Code of Practice. They must also carry out hazard identification and risk assessments, these legal requirements are incorporated into Safety, Health and Welfare at Work Act 2005 (Government of Ireland, 2005). They must also comply with Safety, Health and Welfare at Work (General Application) Regulations 2007 to 2016 (Government of Ireland, 2007) (Government of Ireland, 2016). Tractors, farm machinery and guards must comply with European Communities (Machinery) Regulations 2008 to 2015 (Government of Ireland, 2008) (Government of Ireland, 2011) (Government of Ireland, 2015).
Farmers must ensure their activities do not harm themselves or others. If employed they must co-operate with their employers and use any personal protective equipment to them. Safety hazards must be reported, they must ensure safety devices are not misused, interfered with or bypassed. Farmers should their consult with their employer on matters of safety and health and take account of any training and instruction which they have been given (Government of Ireland, 2005).
7.2 Health and Safety Authority (HSA)
The HSA is tasked with implementing and monitoring many of the accident prevention strategies in Ireland. The aim of these strategies is to improve the level of safety and health in the agriculture sector, to raise awareness and to prevent accidents. They do this by running information campaigns, publishing safety alerts, providing education and training, carrying out inspections, enforcing occupational health and safety legislation and prosecuting farmers when they are found to be in breach of this legislation (Health and Safety Authority, 2017c).
In 2017 the HSA carried out 2000 inspections on Irish farms with a further 2000 planned for 2018 (Health and Safety Authority, 2018). Annual inspection rates have been linked with lower levels of injury and ill-health, with inspections showing positive effect on new recruits. Cuts in public expenditure have affected the annual inspection rate which has fallen since 2009 this may have negative effect on workers’ health and safety in the future (Russell, et al., 2015).
After being inspected 92% of employers said they had an increased commitment to health and safety, 90% believed there was less chance of an accident at their place of work, 89% had a greater understanding of hazards in their workplace and 74% had taken action on health and safety issues that they knew about but had not previously actioned (Health and Safety Authority, 2017c).
7.3 Farm Safety Partnership Advisory Committee
To help improve the level of safety and health the HSA set up the Farm Safety Action Group (renamed Farm Safety Partnership Advisory Committee (FSPAC)), this group included all the major stakeholders in agriculture and could implement a coordinated multiagency approach to health and safety in agriculture. The FSPAC developed Farm Safety Action Plans (2009-2012), (2013-2015) and (2016-2018), which set out goals and associated actions to improve OSH (Health and Safety Authority, Farm Safety Partnership, 2009) (Health and Safety Authority, Farm Safety Partnership, 2013) (Health and Safety Authority, Farm Safety Partnership, 2016).
The 6 goals included in the 2016-2018 which aim to improve OSH in the sector are as follows
•Change cultural behavioural through research, education and training.
•Develop programmes that will foster innovative approaches and deliver engineering solutions to reduce the hazards.
•Reduce the level of injury arising from tractor and machinery use.
•Establish initiatives to reduce number of injuries arising from working with livestock.
•Ensure high standards of health and safety are adopted in timber work on farms.
•Implement programmes for the protection of health and wellbeing of people working in agriculture (Health and Safety Authority, Farm Safety Partnership, 2016).
7.4 Codes of Practice
The HSA produce Codes of Practice with the aim of reducing accidents in the agriculture sector. In 2010 they published Code of Practice on Preventing Accidents to Children and Young Persons in Agriculture. In consultation with FSPAC the HSA has revised the Code of Practice for Preventing Injury and Occupational Ill Health in Agriculture 2017. This revision focuses on improving the level of safety and health of all people in the agriculture by providing practical guidance in the implementation of the Safety, Health and Welfare at Work Act 2005 (Health and Safety Authority, 2017b).
7.5 Education
Hagel, et al., (2008) found that educational interventions alone were not linked with noticeable improvements in farm safety practices, physical farm hazards, or farm-related injury outcomes (Hagel, et al., 2008). Morgaine, et al., (2014) also found in a study in New Zealand that even a well-conducted safety awareness workshop, tailored to farmers was not enough to change safety practices. They suggested that future interventions may be more likely to succeed if they were wide-ranging, included environmental and enforcement features, and target more than one farm member (Morgaine, et al., 2014).
Section 8 Conclusion
Agriculture is one of the most dangerous occupations worldwide, hazards are numerous and diverse. Accidents resulting in fatality or injury are often caused by tractors and farm vehicles; machinery; falls and collapses; and livestock handling. The introduction of ROPS has caused a decline in the number of fatalities and serious injuries due to overturns.
Being hit, run over or crushed by a tractor is still a frequent cause of injuries both fatal and non-fatal. Quad bike fatalities are increasing and research is required into the effectives of ROPS for this type of farm vehicle. PTO entanglements are responsible for 11% of farm fatalities in Ireland and most could be prevented by the use of a guard that complies with the European Standard.
Encounters with livestock frequently result in injuries and fatalities, animal behaviour is unpredictable. Well planned handling facilities can prevent these occurrences. Little is known about the prevalence of zoonotic disease as an occupational health and safety issue in agriculture in Ireland, further research is required in this area.
Work-related injuries are common in agriculture and musculoskeletal disorders are most frequently encountered. MSDs often result in pain and incapacity among farmers. Working long hours; lifting and carrying heavy loads; sustained or repeated full body bending (stoop); very highly repetitive work; excessive force; and very awkward posture during lifting activities; are the causes the main causes of MSDs in agriculture.
Some members of the farming community are at a greater risk of injury, children, young people and older farmers are an example of this. Older farmers’ injuries are thought to be associated with reduced speed of movement and reduced agility. Studies have shown children and young people from farms show more incidences of risky behaviour than non-farm children and young people.
There is conflicting evidence in regards the prevalence of stress in farming but most research agree uncertainties due to markets, farm prices and farm policies; financial worries, excessively long working hours, poor working conditions, poor health and isolation may lead to stress and in turn depression or suicide.
Accident prevention strategies in agriculture are varied. Strategies include education, training, regulatory and enforcement procedures. A coordinated multiagency approach is taken in the form of the Farm Safety Partnership Advisory Committee who produce Farm Safety Action Plans. This approach is proven to work better than education alone in the prevention of agricultural fatalities.
Section 9 Bibliography
“agriculture, n.”, 2018. OED Online. [Online]
Available at: http://www.oed.com/view/Entry/4181?redirectedFrom=agriculture
[Accessed 15 5 2018].Ayers, P., Khorsandi, F., Wang, X. & Araujo, G., 2018. ROPS designs to protect operators during agricultural tractor rollovers. Journal of Terramechanics, Volume 75, pp. 49-55.
Bowman, S. et al., 2009. Impact of helmets on injuries to riders of all-terrain vehicles. Injury Prevention, Volume 15, pp. 3-7.
Bury, D., Langlois, N. & Byard, R. W., 2012. Animal-Related Fatalities—Part I: Characteristic Autopsy Findings and Variable Causes of Death Associated with Blunt and Sharp Trauma. Journal of Forensic Sciences, 57(2), pp. 370-374.
Day, L. M., 1999. Farm work related fatalities among adults in Victoria, Australia: The human cost of agriculture. Accident Analysis & Prevention, 31(1-2), pp. 153-159.
Dillon, E. et al., 2015. Teagasc National Farm Survey: The Sustainability of Small Farming in Ireland. Athenry, Co Galway, Ireland: Teagasc.
Dillon, E., Moran, B., Lennon, J. & Donnellan, T., 2017. Teagasc National Farm Survey Preliminary Results 2017. Athenry, Co. Galway, Ireland.: Teagasc.
Elliot, V. et al., 2018. Towards a deeper understanding of parenting on farms: A qualitative study. PLoS ONE, 13(6), pp. 1-18.
European Commission, 2012. Protecting health and safety of workers in agriculture, livestock farming, horticulture and forestry. Luxembourg: Publications Office of the European Union.
Eurostat, 2018. NACE Rev. 2 Fatal and non-fatal accidents at work by economic activity, EU-28, 2014. [Online]
Available at: http://ec.europa.eu/eurostat/statistics-explained/images/a/ac/Accidents_at_work_YB2016_II.xlsx
[Accessed 17 5 2018].Fathallah, F. A., 2010. Musculoskeletal disorders in labor-intensive agriculture. Applied Ergonomics, 41(6), pp. 738-743.
Furey, E. et al., 2016. The Roles of Financial Threat, Social Support, Work Stress, and Mental Distress in Dairy Farmers’ Expectations of Injury. Frontiers in Public Health, 4(126), pp. 1-11.
Glasscock, D. J., Rasmussen, K., Carstensen, O. & Hansen, O. N., 2006. Psychosocial factors and safety behaviour as predictors of accidental work injuries in farming, Work & Stress. An International Journal of Work, Health & Organisations, 20(2), pp. 173-189.
Government of Ireland, 2005. Safety, Health and Welfare at Work Act S.I. No. 10 of 2005. Molesworth Street, Dublin, Ireland: Government Publications.
Government of Ireland, 2007. Welfare at Work (General Application) Regulations S.I. No. 299 of 2007. Molesworth Street, Dublin, Ireland: Government Publications.
Government of Ireland, 2008. European Communities (Machinery) Regulations S.I. No. 407 of 2008. Molesworth Street, Dublin, Ireland: Government Publications.
Government of Ireland, 2011. European Communities (Machinery) (Amendment) Regulations S.I. No. 310 of 2011. Molesworth Street, Dublin, Ireland: Government Publications.
Government of Ireland, 2015. European Communities (Machinery) (Amendment) S.I. No. 621/2015. Molesworth Street, Dublin, Ireland: Government Publications.
Government of Ireland, 2016. Safety, Health and Welfare at Work (General Application) (Amendment) Regulations S.I. No. 36/2016. Molesworth Street, Dublin, Ireland: Government Publications.
Government of Ireland, 2017. Census 2016 Summary Results – Part 2, Dublin: Central Statistics Office.
Grzebieta, R., Rechnitzer, G., Simmons, K. & McIntosh, A., 2015. Final Project Summary Report: Quad Bike Performance Project Test Results, Conclusions and Recommendations Report 4, 92-100 Donnison Street, Gosford, New South Wales 2250, Australia: The Workcover Authority of New South Wales.
Hagel, L. et al., 2008. Educational interventions delivered via the AHSN program were not associated with observable differences in farm safety practices, physical farm hazards, or farm-related injury outcomes. Injury Prevention, 15(5), pp. 290-295.
Health and Safety Authority, Farm Safety Partnership, 2009. Farm Safety Action Plan 2009- 2012. The Metropolitan Building, James Joyce Street, Dublin, Ireland: Health and Safety Authority.
Health and Safety Authority, Farm Safety Partnership, 2013. Farm Safety Action Plan 2013-2015. The Metropolitan Building, James Joyce Street, Dublin, Ireland: Health and Safety Authority.
Health and Safety Authority, Farm Safety Partnership, 2016. Farm Safety Action Plan 2016- 2018. The Metropolitan Building, James Joyce Street, Dublin, Ireland: Health and Safety Authority.
Health and Safety Authority, 2010a. Code of Practice on Preventing Accidents to
Agr Locus and Superantigen Genes in Clinical Isolates of Methicillin-resistant Staphylococcus Aureus
Children and Young Persons in Agriculture. s.l.:Health and Safety Authority.
Health and Safety Authority, 2010b. Safe Handling of Cattle on Farms – How safe are you – Information Sheet. The Metropolitan Building, James Joyce Street, Dublin 1: Health and Safety Authority.
Health and Safety Authority, 2013. Guidance on the prevention and management of musculoskeletal disorders (MSDs) in the workplace. The Metropolitan Building, James Joyce Street, Dublin 1.: Health and Safety Authority.
Health and Safety Authority, 2017a. Summary of Workplace Injury, Illness and
do not necessarily reflect the views of UKDiss.com.
Association between the agr locus and the presence of superantigen genes in clinical isolates of Methicillin-Resistant Staphylococcus aureus
- Introduction
The use of antibiotics to treat S. aureus infections has led to the selection of antibiotic resistant strains. The first cases of methicillin resistant S. aureus (MRSA) were identified in the 1960’s shortly after its introduction into clinical practice. The β-lactam set of antibiotics work by inhibiting the final stage of cell wall synthesis resulting in cell death. They bind to transpeptidase (a.k.a. penicillin binding protein, PBP), the enzyme responsible for cross linking peptidoglycan chains in the cell wall. Methicillin resistance is conferred by the mecA gene, which encodes a novel penicillin binding protein (PBP2A). This protein has a reduced affinity for β-lactam antibiotics, meaning that these strains are usually resistant to all penicillin-based antibiotics. The mecA gene is carried on a mobile genetic element known as the staphylococcal chromosomal cassette (SCCmec), which can be horizontally transferred between Staphylococcal strains. Several types of these elements have been identified which range in size between 20 and 58kb and carry multiple antibiotic resistances.
One of the antibiotics used to treat MRSA infections is vancomycin; however resistance to this antibiotic has also developed. In 1997 the first vancomycin intermediate-level resistant (VISA) isolate was reported in Japan, soon followed by reports from other countries. Vancomycin resistant isolates (VRSA) were identified in the USA in 2002. Vancomycin is a glycopeptide that functions by inhibiting cell wall synthesis through irreversibly binding the terminal D-alanyl-D-alanine residues of the cell wall precursor. This sequesters the molecules preventing them from being incorporated into the cell wall. Resistance in the VISA strains is thought to be due to changes in peptidoglycan synthesis by synthesising precursors with increased quantities of D-alanyl-D-alanine to bind and sequester the vancomycin.
S. aureus encodes toxin and superantigenes like hemolysins, enterotoxins, exotoxins, exfoloative toxins, toxic shock syndrome toxin (tsst) and leukotoxins as the Panton-Valentine leukocidin (PVL). Different S. aureus strains encode different toxins. Exfoliative toxins, tsst and PVL are only present in some clones, because they are encoded on MGEs, whereas alpha and gamma hemolysin are encoded in the core-genome and produced by most strains. Differential expression of core-genome encoded genes will nevertheless result in differences in pathogenesis. A reduced toxicity could to some extent hide the bacteria from the immune system and may therefore facilitate a more stable and successful colonization of the host. This could explain why this particular lineage shows a broader host capacity compared to most other S. aureus lineages. However, there are a number of un-described genes in the MRSA stains which could encode virulence factors associated with infections in animals and human. Global regulators help bacteria to adapt to a hostile environment by producing factors enabling the bacteria to survive and subsequently to cause infection at the appropriate time. Several of these global virulence regulators, such as the agr system, Sar and Sae, have been well characterized.
The production of Staphylococcus aureus virulence factors is directly related to methicillin resistance. The presence of a PBP protein in the structure of MRSA causes a change in the production of pathogenicity factors. The mecA gene indirectly activates AIPs, which play an important role in the production of biofilms, quorum-sensing (QS), as well as the emergence of some regulatory factors. Beceiro et al. reached similar conclusions after demonstrating that methicillin resistance reduces the virulence of MRSA by interfering with the agr QS system in such a way that the ability of the bacteria to secrete cytolytic toxins is reduced(1). Increasing the expression of genes involved in PBP production in more resistant strains can justify this. Because antibiotic resistance to non-pathogenic strains is different in pathogenic strains. These authors state that methicillin resistance induces cell wall alterations that affect the Agr quorum-sensing system of the bacteria. This leads to reduced expression of the toxin and lowered virulence in a murine model of sepsis. This is a typical example of how the acquisition of resistance to a specific antibiotic (oxacillin) is related to a decrease in virulence.
In this research, with the aim of investigating the relation between agr regulatory system and pathogenic factors, MRSA and non-MRSA strains were examined. Considering the assumption of association between virulence factors and antibiotic resistance, the general structure of the study designed.
2.Material and Methods
2.1. Isolation and Identification of S. aureus
This cross- sectional study was designed to measure the prevalence of Methicillin – resistant Staphylococcus aureus among patients and healthcare workers in Hamedan (Group 1) and sistan and baluchestan (Group 2) single patients attending 9 healthcare institutions (3 hospitals, 4 clinical laboratories, and tow healthcare center) located in different geographic regions of Iran, covering the west and South between July 2015 and August 2016. Clinical specimens were inoculated on to blood agar base (Merk, Darmstadt, Germany) to which 5% sheep blood was added and mannitol salt agar (Merk, Darmstadt, Germany) by using streaking method. Inoculated plates were incubated at 35-37ºC for 18 to 24 hours aerobically. Bacterial colonies showing typical characteristics of S. aureus (i.e., beta hemolytic on blood agar and colonies with golden yellow pigmentation on mannitol salt agar) were subjected to subculture on to basic media, gram stain and biochemical tests like catalase and coagulase tests. Catalase positive and gram-positive bacteria appearing in grape like cluster was spot inoculated to DNase agar (Merk, Darmstadt, Germany). Inoculated DNAse agar plates were incubated at 370C overnight and flood with 1N HCl (Merk, Darmstadt, Germany). Isolates that hydrolyzed DNA in DNAse agar were considered S. aureus. (2).
2.2. Detection of MRSA and Determination of Antimicrobial Susceptibility Profile of each isolate
Antimicrobial susceptibility test was carried out by the Kirby Bauer disc diffusion method as per Clinical Laboratory Standards Institute (CLSI) guidelines on Muller Hinton agar (Merk, Darmstadt, Germany). The following drugs and concentrations were used to determine the antibiogram of the strains: pencillin (10U), tetracycline (30g), clindamycin (30g), gentamicin (30g), ciprofloxacin (1.25/23.75 g), erythromycin (15g), chloramphenicol (30g), rifampin (5g), trimethoprim- sulfamethoxazole (10g) and linezolid (30g). All antibiotic disks were obtained from MAST® Company, United Kingdom. The diameter of the zone of inhibition around the disc was measured using sliding metal caliper. Methicillin susceptibility was determined using the cefoxitin Etest (Liofilchem, Italy) and oxacillin E-test (AB BIODISK, Sweden) for conformed Minimum Inhibitory Concentration (MIC) of strains.The results were evaluated using the latest CLSI version. To control the quality and evaluate the results, staphylococcus aureus ATCC25923 was used as negative control and Staphylococcus aureus ATCC43300 was used as positive control.
2.3. Genomic DNA Extraction
For S. aureus, genomic DNA was extracted using a protocol adapted from Bae et al. Briefly, 3 ml of an overnight culture were harvested and resuspended in 50 µl of TE supplemented with lysostaphin (final concentration 0.5 µg/ml). After 30 minutes of incubation at 37°C, 300 µl of “Nuclei lysis solution” (Promega Corporation, Madison WI, USA) were added and the cell suspensions were heated at 80°C for 10 min. The samples were then treated with RNase and addition of 100 µl of “Protein precipitation solution” (Promega Corp) was followed by incubation for 5 minutes on ice. After centrifugation (4°C, 13’000 rpm), supernatants were collected and 300 µl of isopropanol were used to precipitate the DNA, which was subsequently washed with 70% ethanol, pelleted by centrifugation, air-dried and re-diluted at 4°C overnight in 20 µl of EB. (3).
2.4. PCR for Superantigen genes and Screening for strains
The superantigene genes were amplified with specific primers listed in Schlievert et al(4) and Jarraud et al (5)studies. The programmable thermal cycler (Eppendorf, Mastercycler® 5332, Germany) PCR device was used in all PCR reactions. 25 µl of the final solution containing 2 µl DNA templates, 1 µl of each primer with a concentration of 25 pM and 25 µl of PCR Master Mix (Ampliqon, Germany) (containing Tris-Hcl PH8.5, (NH4) SO4, 3 mMMgcl 2, 0.2% Tween 20, 0.4MmdNTP, 0.2-unit Ampliqon polymeras, Insert red dye and stabilizer) was used for PCR reaction. The remaining volume was compensated by distilled water. PCR reaction conditions were performed as indicated in Table 1.
About 5 – 10 µl of PCR product was combined with loading buffer and loaded on 1.5% agarose gel containing GelRed 3X (Biotium, Fremont, CA). Electrophoresis was carried out in 1xTBE buffer at 85V for 40 to 55 min. 100 bp Fermentas marker (Thermofisher, USA) was used for the identification of the target bond, their bands visualized under UV-light and documented using a gel documentation system.
Table1. Multiplex Primers used for methicillin resistance and superantigenes genes in S. aureus
2.5. agr typing
Classification of agr system groups was based on the hyper variable domain of agr locus according to Soares et al(6). Duplex PCR was performed to type groups based on their products size. PCR products were separated by electrophoresis on 1% agarose gels which were stained with containing GelRed 3X (Biotium, Fremont, CA). Electrophoresis was carried out in 1xTBE buffer at 85V for 55 min. 100 bp Fermentas marker (Thermofisher, USA) was used for the identification of the target bond, their bands visualized under UV-light and documented using a gel documentation system.
Table 2. Toxins Primers used for
Ref Reaction conditions Product Size Primers genes (7) 94°C 10´ (94°C 1´, 56°C 1″, 72°C 1´) 25x
72°C 10´
440 F: ATGCACATGGTGCACATGC R: GTCACAAGTACTATAAGCTGCGAT
agrA 572 F: ATGCACATGGTGCACATGC R: GTATTACTAATTGAAAAGTGCCATAGC
agrB 404 F: ATGCACATGGTGCACATGC F: CTGTTGAAAAAGTCAACTAAAAGCTC
agrC 888 F: ATGCACATGGTGCACATGC R: CGATAATGCCGTAATACCCG
agrD 2.6. Statistical analysis
Data was tabulated and analyzed using the Statistical Package for Social Sciences (SPSS) software, version 16. The correlation between phenotypic antibiotic pattern and agr locus, phenotypic antibiotic pattern and superantigens genes, superantigenes genes and agr locus, source of bacteremia and agr locus in S. aureus isolates was evaluated by the Chi-squared test and T-test for a single proportion. The difference in the time of admission and blood sample collection as well as the difference in the time of blood sample collection and nasal swabbing was statistically evaluated by Mann-Whitney U Test. Statistical significance was set at a p value of 0≤05.
3.Results
3.1. Prevalence of clinical isolates
Overall 1009 clinical S. aureus samples were collected from patients in Hamedan (Group 1) and sistan and baluchestan (Group 2). One hundred and sixty (160) samples were colleted from group1 and one hundred and ninty (190) samples were collected from group2. During the collections of S. aureus samples from the patients, it was found out that some of the patients were suffering from both Staphylococcus aureus and the pseudomonas aeruginosa. In group1, S. aureus strains were isolated from different clinical samples’ sources including 39 isolates (24.37%) of wounds, 58 isolates (36.25%) of blood, 32 isolates (20%) of urine, 11 isolates (6.87%) of catheter, 6 isolates (3.12%) of aspiration and 14 isolates (8.75%) of sputum. Also, in group2; most of the samples were collected from wounds 61 isolates (31.10%) and other samples including 41 isolates (21.57%) of blood, 27 isolates (14.21%) of urine, 26 isolates (16.68%) of catheter, 15 isolates (7.89%) of aspiration and 20 isolates (10.52%) of sputum.

Figure 1. Distribution of different samples between group1 and group2 Staphylococcus aureus.
3.2. Anitibiotic resistance profils and MIC
Of 160 obtained isolates of group1, 129 isolates (80.62%) were resistant to pencillin, 79 isolates (49.37%) were resistant to tetracycline, 84 isolates (52.5%) were resistant to clindamycin, 91 isolates (56.87%) were resistant to gentamicin, 88 isolates (55.5%) were resistant to ciprofloxacin, 69 isolates (43.12%) were resistant to erythromycin, 97 isolates (60.62%) were resistant to chloramphenicol, 4 isolates (2.5%) were resistant to linezolid, 49 isolates (30.62%) were resistant to trimethoprim- sulfamethoxazole and 11 isolates (6.87%) were resistant to rifampin. In addition, according to the results of determining minimum inhibitory concentrations (MIC) of Etest strips, 2 (1.2%) isolates were semi-resistant to vancomycin ~3µ/ml, 59 (36.87%) isolates were resistant to oxacilin≥ 4µ/ml and 61 isolates (38.12) isolates were resistant to cefoxitin≥ 8µ/ml were identified. Also, sixtyone (38.12) MRSA strains were isolated from clinical and screening samples.
Among of 190 clinical S. aureus samples of group2, 169 isolates (88.94%) were resistant to pencillin, 104 isolates (54.73%) were resistant to tetracycline, 97 isolates (51.02%) were resistant to clindamycin, 88 isolates (46.31%) were resistant to gentamicin, 121 isolates (63.68%) were resistant to ciprofloxacin, 108 isolates (56.84%) were resistant to erythromycin, 97 isolates (49.98%) were resistant to chloramphenicol, 7 isolates (3.6%) were resistant to linezolid, 51 isolates (26.82%) were resistant to trimethoprim- sulfamethoxazole and 9 isolates (4.73%) were resistant to rifampin. In addition, according to the results of determining minimum inhibitory concentrations (MIC) of Etest strips, 4 (2.1%) isolates were semi-resistant to vancomycin ~3µ/ml, 98 (51.50%) isolates were resistant to oxacilin≥ 4µ/ml and 99 isolates (52.10%) isolates were resistant to cefoxitin≥ 8µ/ml were identified. Also, sixtyone (52.10%) MRSA strains were isolated from clinical and screening samples.
Table 2. Antimicrobial resistance profiles of MRSA, MSSA, and S. aureus isolates.
In group1; Most of the MRSA samples were isolated from blood and wounds. The percentage of MRSA in blood, and wounds was 66.66% (26 isolates) and 55.17% (32 isolates) respectively; whereas the percentage of MSSA in aspiration 0% (0 isolates) and spatum 16.66% (1 isolates) respectively. in group2; Most of the MRSA samples were isolated from blood and wounds. The percentage of MRSA in blood 72.13% (44 isolates) and wounds 46.34% (19 isolates) was respectively; whereas the percentage of MSSA in aspiration 26.66% (4 isolates) and spatum 10% (9 isolates) respectively.
3.2. Superantigenes genes profils
Out of 193 S. aureus isolates of sistan and baluchestan, 97(50.25%) isolates of Zahedan, 31(16.06%) isolates of Khash and 66(34.19%) isolates of Iranshahr was perfomed. Also, of 193 sistan and baluchestan S. aureus, seq had the highest frequency and edinB had the lowest frequency, which was positive in 29(15.02%) isolates and 3(1.15%) isolates, respectively. In addition, out of 165 S. aureus isolates of Hamedan, the saq gene found in 22(13.33%) isolates was more abundant. None of the isolates of S. aureus isolated from Hamadan had etD, etA, etB, lukF-PV and lukE-lukD genes. The prevalence of SAgs genes in female patients is higher than that of male patients. Frequency of these genes was also reported in MSRs strains of MRSA. In addition, MDR strains also had the highest presence of SAgs genes (Table1,2).
.
Table2. Prevalence of SAgs genes in S. aureus isolates from patients of group 1 and group 2
3.4. agr Typing
In group 1, a total of 160 isolates of S. aureus contained 104 isolates (65%) with agr gene and 56 isolates (35%) lacking agr gene. The frequency of locus agr was that 27 isolates (25.96%) were agrA gene, 49 isolates (47.11%) were agrB gene, 17 (16.34 %) isolates were agrC gene and 11 isolates (10.57 %) were agrD gene. In group 2, a total of 190 isolates of S. aureus contained 132 isolates (69.47%) with agr gene and 58 isolates (30.52%) non agr gene, agrA in 39 isolates (29.54%), agrB in 55 isolates (41.66%), agrC in 29 isolates (21.96%) and agrD in 9 isolates (6.81.96%) were positive (Table3,4).
Table 3. Characteristics of the agr allelic profiles of group1 S. aureus
Table 4. Characteristics of the agr allelic profiles of group2 S. aureus
Superantigen and Toxins
MRSA MSSA Total Genes Total MRSA Total MSSA p.value agr typing agr typing I II III IV ND I II III IV ND SEA 4 14 3 2 3 1 2 1 0 3 26 20 6 p<0.05 SEB 3 5 2 0 1 2 2 1 0 4 19 11 8 p<0.05 SEC 5 7 2 1 4 0 2 0 0 0 21 19 2 p<0.05 SED 5 4 2 1 1 2 2 0 0 3 17 13 7 p<0.05 SEE 4 9 0 0 3 1 2 0 0 0 19 16 3 p<0.05 SEl-G 7 4 0 0 0 1 3 0 1 0 16 11 5 p<0.05 SEl-H 4 1 1 0 3 1 3 1 0 2 16 9 7 p<0.05 SEI 6 3 0 2 4 4 1 0 0 0 20 15 5 p<0.05 SEl-J 7 2 1 0 5 1 1 0 0 0 14 16 2 p<0.05 SEl-K 9 2 1 0 0 0 2 0 0 0 13 11 2 p<0.05 SEl-L 7 4 1 0 7 0 2 0 0 0 21 19 2 p<0.05 SEl-M 7 9 1 0 1 5 1 1 0 2 26 17 9 p<0.05 SEl-N 6 3 0 1 1 3 1 1 0 3 19 11 8 p<0.05 SEl-O 7 9 1 0 6 4 1 0 0 1 29 23 6 p<0.05 SEl-Q 8 3 2 1 3 2 0 0 0 0 19 17 2 p<0.05 TSST-1 6 2 1 0 0 1 3 0 0 1 14 9 5 p<0.05 etA 5 2 1 0 1 2 1 0 0 0 11 9 3 p<0.05 etB 4 3 0 1 0 1 0 0 0 0 9 8 1 p<0.05 lukS-PVL 1 3 0 0 1 1 2 0 0 0 8 5 3 p<0.05 lukF-PV 1 2 0 0 2 1 2 0 0 3 11 5 6 p<0.05 lukE-lukD 1 4 0 0 1 0 0 0 0 0 6 6 0 p<0.05 edinA 0 0 0 0 0 0 0 0 0 0 0 0 0 p<0.05 edinB 0 0 0 0 0 0 0 0 0 0 0 0 0 p<0.05 edinC 0 0 0 0 0 0 0 0 0 0 0 0 0 p<0.05 3.4. Statistical Comparison
In this study, using t-test and Chi-2, there was a significant relationship between the frequency of genes of the SAgs of groups 1 and 2 that agr locus. Also, with regard to two variables of phenotypic antibiotic resistance and mecA gene, a significant relationship was also found. In this way, the isolates collected from group 2 had a different frequency than group 1.
5.Discussion
S. aureus is one of the most adaptable bacteria that can survive due to environmental conditions. Antibiotic resistance in S. aureus has a direct relationship with this bacterial property, which can cause new strains. MRSA, is one of the most important bacteria that causes toxic infections. Meanwhile, the presence of mecA gene in clinical isolates can alter the pathogenicity of this bacterium. Also, the activity of this gene can change the bacterial phenotypic resistance pattern, which, along with other variables, causes the emergence of new strains. In this study; we examine the clinical and genetic results of the MRSA strains from the Hamedn (group1) and sistan and bluchestan (group2) hospitals and different strains of S. aureus were isolated showing methicillin resistance (MRSA), methicillin susceptibility (MSSA), and multi-resistance. According to many studies, there are several antibiotics in the MRSA strain, and there is a direct relationship between the presence of the mecA gene and the bacterial phenotypic resistance. Studies by Vitali et al.(8), Duran et al.(9) and others Showed that the presence of the mecA gene could affect Staphylococcus aureus strains in terms of antibiotic resistance patterns. In explaining this, it should be explained that the gene is located on an SCCmec movement elemnt that can cause differences in the strain. The SCC is a large fragment of DNA that is always inserted into the S. aureus chromosome. There are other SCC groups that do not confer methicillin resistance, so these are referred to as non-SCCmec groups. All MRSA contain one type out of eight (or more) SCCmec types. These different types are responsible for different our versus in group1 and group2, which cause distinct infectious syndromes in different patient populations.The results of antimicrobial resistance studies conducted in group2 have shown a high prevalence of resistance to antibiotics. In both groups, the majority MRSA strains were multiresistant to more than five classes of antibiotics including; gentamycin, rifampin, tetracycline, erythromycin and Ciprofloxacin. Incidences of MRSA strains were high in blood and wounds. Also, vancomycin intermediate S. aureus (VISA) strains in group 2 were observed more than group 1, which could be involved in several factors. Age, gender, climatic conditions, food type and regional culture are risk factors that are responsible for the high frequency of antibiotic resistance in different strains of the country. According to Lundgren et al.(10), Norris et al.(11) and Wushouer et al.(12) cultural factor is one of the most important causes of antibiotic resistance. However, the frequency of antibiotic resistance is also different, even in two different regions of the country, where the culture of drug use and antibiotic use is different. Our research at patient sampling showed that patients in group 2 were more interested in taking different drugs, and patients in group 1 showed less willingness to take medication.Culture factor can even change the regulatory system and pathogenicity of bacteria.
S. aureus strains, expressing the accessory gene regulator (agr) related virulence factors or superantigenes toxins, display a clear resistance against autophagic removal by preventing autophagosome maturation. These strains escape from the autophagosome into the cytoplasm, leading to death of the host cell and bacterial release. The involvement of single virulence factors, such as pore-forming toxins in S. aureus intracellular survival, depends on bacterial strains and type of host cell. In our study, the frequency of enterotoxin and superantigen genes in group 2 was higer than that of group 1, so that the tst, etA and etB genes were more observed in this group. In justification and description, the presence of the mecA gene in MRSA strains causes the change of virulence factors in bacteria. In this way, the activity of this gene affects some structural proteins such as agr, and it makes a lot of changes by activating this locus of the gene. Many SAgs such as TSST-1 are regulated by agr, which appears to be dampened during colonization, suggesting that agr-controlled SAgs may not be involved in colonization. Since it is likely that agr is downregulated during colonization as discussed previously, it has been suggested that certain SAgs such as SEA, which is not regulated by agr, may play a role early on in colonization. Thompson et al.(13), Soares et al.(6) and Yu et al.(14) in their research suggested that Locus agr is one of the most important factors in increasing the pathogenesis of MRSA strains. Despite the fact that many persistent carriers contain the bacteriophage that carries SEA, this genetic element does not appear to play a role early on during colonization. Furthermore, the sea gene has been correlated with sepsis, although the presence of SEA has yet to be confirmed in blood during sepsis. The combination of these factors with virulence factors in group 2 is higher than group 1 due to the fact that along with culture factor, type of food, environmental and temperature conditions, can play a role in the pathogenesis of S. aureus. These factors indirectly activate some oprons. This idea also demonstrated a correlation between the egc operon of SAgs and colonization. Stach et al in.(15) own study using recombinant SAgs found that both types of SAgs (egc and non-egc) induced similar proliferative activity on PBMCs. However, the proliferative potential of supernatants taken from patients with strains containing egc genes demonstrated that strains encoding egc SAgs do not have as high proliferative activity as strains encoding non-egc SAgs, suggesting that egc toxins are not made in quantities as high as non-egc ones. A lack of neutralizing antibodies against egcencoded SAgs was also found in serum from healthy humans, although both egc and non-egc SAgs have been shown to be expressed in nasal carriers suggesting an inability to form antibodies against egc toxins. It is interesting that only non-egc encoded SAgs have been implicated in toxin-mediated diseases. Thus, the role of egc-encoded SAgs in colonization requires further investigation.
In this study, correlation between agr lucus and SAgs profiles were observed. Meanwhile, Deodhar et al.(16) and Elazhari et al.(17) reported that there is a significant relationship between the mecA– agr locus and SAgs – agr locus. The various factors mentioned above can play an important role in establishing this relationship. On the other hand, the results of our study indicate that the frequency of agrA and agrB in the staphylococcal isolates is higher in both groups. The locus is expressed from two divergent promoters, P2 and P3, of which the P2 transcript
Robotics AI Applications & Their Architectural Support
covers a 4-gene operon, containing agrB, D, C, and A. agrA and C constitute a classical two-component signaling module and agrB and D combine to generate the activating ligand. The autoinducing peptide (AIP) binds to and activates agrC, which activates agrA and the activated agrA upregulates its own promoter P2 as well as that of the adjacent and divergent RNAIII promoter, P3. RNAIII appears to be the major effector molecule of the agr system. It is thought to regulate most target genes at the level of transcription but has also been shown to affect the translation of some genes. RNAIII, RNAII and egc operon plays a key role in the SAgs-toxins central regulatory circuit and coordinately regulates several virulence associated genes.
6.Conclusion
INTRODUCTION
A major challenge in robotics is the integration of symbolic task goals and low-level continuous representations. In the research area of object grasping and manipulation, the problem becomes a formidable challenge. Objects have many physical attributes that may constrain planning of a grasp, as also robots have limited sensorimotor capabilities due to their various embodiments. Considering the problem at hand, multiple approaches take their inspiration from imitation studies in developmental psychology: infants are able to infer the intention of others, and understand and reproduce the underlying task constraints through their own actions [1]. This goal-directed imitative ability is obtained along multiple stages in a developmental roadmap, both through the infant’s own motor exploration (trial and error) and through the observation of others interacting with the world (imitation learning) [2]. Roboticists follow a similar developmental approach in order to design architectures for artificial agents [2], [3], [4], [5]. Most of these works, however, focus on the exploratory stage, where robots obtain object affordances through their empirical interaction with the world. The affordances being modeled are measured as the salient changes in the agent’s sensory channels, which are interpreted as effects of specific actions applied on objects [4]. As an example, an effect of poking a ball is making it roll. Though it is an important step for a robot to discover this motor ability, another necessary step to achieve goal-directed behavior is to link this immediate motor act and its effects (as to poke the ball and let it roll), to the conceptual goal of an assigned task (as to provide the ball to a child). While trial-and-error-based exploration can be seen as inefficient to solve such goal learning problems, human supervision is helpful. This motivates an idea different from the classical developmental studies in such a way that it incorporates taskspecific inputs from a human teacher. Thus, a system would be able to learn natural, goal-oriented types of grasps in a more efficient way. We clarify this idea in the hand-over task shown in Fig. 1. Such a task requires enough free area for another person to grasp the object. The robot should learn that an important constraint for this task is free area. There are numerous similar examples, e.g. pouring water from a cup requires the opening of a cup uncovered, and using a knife needs the robot to grasp the handle part. We believe these links can efficiently be learned by the input from a human expert. In this work, we develop such a method for learning of task goals and task relevant representations. The learning is performed in a high-dimensional feature space that takes into account different object representations and robot embodiments together with an input from a teacher.
RELATED WORK :-Deriving quantified constraints from conceptual task goals presents a challenge similar to integrating high-level reasoning with low-level path planning and control systems in robotics. The main challenges originate from the representational differences in the two research fields. [6] addresses this problem through statistical relational models for a high-level symbolic reasoner, which is integrated into a robot controller. [7] proposes a coherent control, trajectory
optimization, and action planning architecture by applying the inference-based methods across all levels of representations. In our work, we directly approach the task-oriented grasping problem considering characteristics of a real robot system. .A concept of providing expertise about task semantics through human tutoring has been implemented in [14]. To realize this, we take a widely used probabilistic graphical model, Bayesian Network [15]. This model will be used to encode the statistical dependencies between object attributes, grasp actions and a set of task constraints; therefore to link the symbolic tasks to quantified constraints. The main contributions of our work are (i) introducing a semi-automated method for acquiring manually annotated, task-related grasps; (ii) learning probabilistic relationships between a multitude of task-, object- and action-related features with a Bayesian network; (iii) thus acquiring a hand-specific concept of affordance, which maps symbolic representations of task requirements to the continuous constraints; (iv) additionally, using a probabilistic framework, we can easily extend the object and action spaces, and allow flexible learning of novel tasks and adaptation in uncertain environments; (v) finally, our model can be applied to a goaldirected imitation framework, which allows a robot to learn from humans despite differences in their embodiments.
III. DEFINITION OF FEATURE SUBSETS
To introduce our approach, we first identify four subsets of features which play major roles in the consideration of a task-oriented grasp: task, object features, action features, and constraint features.
TASK FEATURES :-
In our notation, a task T ∈T ={T1,…,TnT} refers to a ‘basic task’ that involves grasping or manipulation of a single object. According to [17], such a basic task can be called a manipulation segment which starts and ends with both hands free and the object at the stationary state. These manipulation segments are the building blocks for complex manipulation tasks
.OBJECT FEATURES :-
An object feature set O = {O1,…,OnO} specifies the attributes (e.g. size) and/or categorical (e.g. type) information of an object. The features in O are not necessarily independent. The same attribute, such as shape, can be represented by different variables dependent on the capabilities of the perceptual system and the current object knowledge.
ACTION FEATURES :-
An action feature set A = {A1,…,AnA} describes the object-centered, static and kinematic grasp features, which may be the direct outputs of a grasp planner. A may include properties like grasp position, hand approach vector, or the grasp configuration.
CONSTRAINT FEATURES :-
Finally, constraint feature set C ={C1,…,CnC}specifies a set of constraint functions which is defined by human experts; we term these to be a range of variables representing functions of both object and action features. As an example in a grasp scenario (like in Fig. 1), one may define the enclosure of the object volume as a constraint feature, which obviously depends on both object features (size and shape) and action features (grasp position and configuration). Thus, constraint features form the basic elements
BAYESIAN NETWORK MODELLING :-
Given a complementary set of variables {T,O,A,C} =X , our focus is to model the dependencies between their elements using a Bayesian network (BN) [15] (see an example network in Fig. 2). A BN encodes the relations between the set of random variables X = {X1,X2,…,Xn}. Each node in the network represents one variable, and the directed arcs represent conditional independence assumptions. The topology of the directed arcs is referred to as the structure of the network, and it is constrained to be directed and acyclic, meaning there are no cyclic connections between the nodes.

Fig. 2. Experimentally instantiated Bayesian network. The coarse structure of the BN specifies the subset dependencies between T,O,A,C. The fine policy specifies the dependencies between variables within each feature subset. The latent variables for GMM nodes are not shown here.
EXPERIMENTAL SETUP :-In this section, we will describe the application of the trained BN for three different experiments. While two of them will mainly provide a view on the evaluation of the technique, the third one will show a setup for robot imitation based on task-constraints. For each experiment, we formulate the corresponding semantic questions to the system.
A. “From where to grasp an object, given a task?”
Formulating this question as P(upos|task, size, conv), our goal is to observe how our three tasks influence the position of a grasp, upos. As representatives for the experimental results, we select a hammer, a bottle, and a mug out of the 25 object models as the test set, and train the Bayesian network using the Schunk hand data stored from the remaining 22 models
.Analyzing the results, we have the following observations: (i) the BN is clearly affected by the BADGr planner, providing a lot of “from where to grasp” hypotheses from the four sides, top and bottom of an object. (ii) Given a hand-over task, the results do not substiantially differ, and all major directions are valid. (iii) Given a pouring task, the network clearly rejects to grasp from the top in cases of bottle and mug.B. “Can you imitate this demonstrated grasping task?”
In the first step, the robot observes a human performing a grasp on an object, and estimates the intention (task) tH of the human action. PH(T|O,A,C) encodes the probability of the tasks for the demonstrated object-grasp combination, where PH means that the BN is specific to the demonstrator’s embodiment. We denote the maximum-likelihood estimate of the task as ˆ tH. In the second step, the robot finds the most compatible grasp on the object(s) it perceived, in order to achieve the same task ˆ tH. This step can be formulated as a Bayesian decision problem, where a reward function r defines the degree.
Matching of Tasks: The objective is to plan a grasp to match the same task while the robot is given six objects (see Tab. IV). In step 1, the robot estimates the most likely task of the demonstrated grasp to be pouring ˆ tH = T2. In the second imitation step, the robot first follows step 2.1 to select the object o∗ ∈ O that best affords T2, and then step 2.2 to select the grasp action a∗ ∈A that best affords T2. The results of the second step are illustrated in the two left bar plots in Tab. IV.- Matching of Tasks and Features of Object and Action: In this scenario, the objective is not only to choose the object and action that afford the task, but also to select those that are similar to the object used by the human and the grasp the human applied, i.e. matching their features. This requires adding to the objective function a similarity measure between o and oH, and between a and aH. The results of the second step of imitation are illustrated in the two right bar plots in Tab. IV. Note that the feature vectors o and a are both concatenations of multiple variables, such as egpc and upos for a.
CONCLUSIONS & FUTURE WORK FOR APPLICATIONS :-
Our approach is semi-automated and embodiment-specific. A simulation-based grasp planner generates a set of hand-specific, stable grasp hypotheses on a range of objects. A teacher provides the knowledge of task requirements by labeling each hypothesis with the suitable manipulation task(s). The underlying relations between the conceptual task goals and the continuous object-action features are encoded by the probabilistic dependencies in a Bayesian network. Using this network as a knowledge base, the simulation experiments showed that the robot is able to infer the intended task of a human demonstration, choose the object that affords this task, and select the best grasp action to fulfill the task requirements. Though we implement and test the current framework based on the BADGr grasp planner [12], this task constraint framework can be integrated with any grasp planning system.
ACKNOWLEDGMENTS :-
This work was supported by EU IST-FP7-IP GRASP, EU IST-FP6-IP-027657 PACO-PLUS, and Swedish Foundation for Strategic Research.
ACCOMPLISHMENTS & IMPLEMENTATIONS IN ROBOTIC HARDWARE :-
In 2015 about 90% of robots in use didn’t use sensors. Most of these are the standard in industry today[23]. They are placed inside a controlled area to fulfill their functions as shown in figure 1. This achieves approximately 10% of manufacturing industry penetration [23]. Robotic systems need to be able to operate in a dynamically changing environment and must be able to obtain enough information on positions of themselves, obstacles, objects, and interaction partners [26]. The number of sensors being added is increasing. Vision is becoming incorporated in sensing, and Artificial Intelligence (AI), especially in the form of neural networks, is being used for robotic systems in learning to improve. Both AI and vision sensing require increased processing power.Movements are becoming more complex because robotic systems not only need to complete preplanned actions related to their task, but have to be able to process kinematics planning at higher speed to work in a dynamic environment [27]. Faster kinematics planning also needs higher computational ability. CPUs were the first choice for processing. GPUs now hold supremacy as the choice of processing for graphics and AI, though this may change as new chips for AI become available [25]. Field Programmable Gate Arrays (FPGAs) are also being used to process video and kinematics to speed up movement planning[27] and image processing [28][29]. Increasingly autonomous robotic systems require a shift in design towards lighter weight, and more energy efficient platforms over the more common geographically rigid industrial systems in use. This opens opportunities for combining on board processing with distributed or cloud computing to achieve high performance while circumventing space and power consumption restrictions of smaller robotic platforms [26].
Figure 1 [24]
Vision
Processing video is a computationally intensive task. One of the more recent advancements has been in the use of smart cameras, or cameras with on board processing power. Normal cameras provide raw data in the form of many images which have to be processed by off-board computer systems in the robots local environment because of bandwidth restrictions which don’t allow for the streaming at a high enough speed for fast movement [30]. Smart camera systems provide image information instead of being limited to provision of raw image data. This provides the robotic system with high level results of image analysis to be precisely integrated in task planning software. Although the data is somewhat dated, we can get an idea of possible distributed computing performance gain from work by Bistry and Zhang in A Cloud Computing Approach to Complex Robotic Vision Tasks using Smart Camera Systems. They test four different systems and results are shown in table 1. The systems use a feature extraction algorithm based on OpenCV and can be used to compare time required to identify objects by CPU and/or smart cameras. They create a framework which uses the SIFT (Scale-Invariant Feature Transform) algorithm. SIFT discovers significant points in an image and describes them in a way such that the description is invariant to rotation, translation, and scaling. Their framework is unique in that the image processing algorithms aren’t rigid, they can be replaced at runtime.
System 1 SIFT vectors of images are computed on the intelligent camera system and distributed to the image matching process over eight systems in the network which are Core 2 Duo, 2.4 GHz. Each system generates feature vectors of the objects to be detected and attempts to match it to the current feature vector. The task has a goal of detecting 100 objects. WiFi usage is kept low by requiring one of the systems to be a feature vector distributor for the eight-member cloud of computers.
System 2 uses additional hardware on the service robot TASER. Two laptops with Core 2 Duo 2.2 GHz processor are installed on the robot and the smart camera splits the image into two regions with one sent to each laptop which splits it again for each of its CPU cores.
System 3 does all the computational processes over the network using the smart camera as a normal Ethernet camera and processing the image data using the laptops removed from system 2.
System 4 does the complete image processing on the control PC of the service robot which has a Pentium 4 2.4 GHz. The PC also runs several real-time tasks for the robot and has approximately a 60% load. Similar to system 3, the camera does no preprocessing of image data [31].
Table 1 Image Processing Comparison System Extraction Matching Data Transfer 1 6781 ms 381 ms 16 ms 2 269 ms 376 ms 62 ms 3 274 ms 383 ms 695 ms 4 4110 ms 10428 ms 50 ms From the table we see that the best extraction time is from system 2 where the images are split by the smart camera, and the laptops on board do the matching the quickest. We could obtain the best results overall if we split the image with the smart camera as in system 2, and then did the matching and data transfer with the cloud type setup in system 1.
On board vision processing has improved substantially. FPGAs have the advantage of running image processing algorithms on reprogrammable hardware with parallel processing capabilities. Successful work has been done using histogram of oriented gradients (HOG) and average magnitude difference function (AMDF) on Altera’s Cyclone II [29]. Reducing the floating point simulation in Matlab to integer numbers lowered the success rate in object recognition from 100% to 95.95%, 95.89%, and 95.76% even with introduction of salt and pepper noise at 5%, 10%, and 25% respectively for an overall result of approximately 95% [29]. The system could classify 250 shapes in leather per second, and the introduction of noise showed the application to be viable for industrial settings. A smart camera has also been implemented using a digital camera and an FPGA-SoC device benefiting from a remote client for observation of the visual processing [28]. The architecture is able to extract real-time data and has shown to work on robotic platforms with future work being described as including object recognition or facial expression recognition [28].
Nvidia has also created a new full Linux system the size of a Raspberry Pi with a GPU based on their Pascal architecture which will aid in computer vision and navigation [32]. The Nvidia Jetson TX2 supplies 1.5 teraflops of processing power, WiFi, and includes 64bit Denver 2 and A57 CPUs with 8GB of 12bit LPDDR4 memory along with the ability to encode and decode video at 2160p at up to 60fps [32]. The Tx2 represents the trend towards small systems which can be used for robots, drones and other devices which are increasingly dependent on vision.
Kinematics
Motion planning is one of the most time-consuming tasks for robotic movement. For a robotic arm and gripper, the majority of the time required for the motion-planning algorithm is devoted to figuring out how to get the gripper to where it needs to go without the arm unintentionally running into something else. Collision detection processing takes 99% of the time required for motion planning [33]. GPUs can achieve motion plans on the order of hundreds of milliseconds, but power consumption is in hundreds of watts, and is not feasible for untethered robots [33].
A probabilistic road map(PRM) is a graph of points in obstacle free space with lines referred to as edges connecting points where direct movement between them doesn’t result in a collision [27]. Researchers at Duke combined aggressive precomputation which happens when first setting up the robot, and massive parallelism generating a large PRM with approximately 150,000 edges representing possible robot motions while avoiding self-collisions and collisions with objects which don’t change position such as the floor [27]. To trim down the PRM they simulated 10,000 scenarios with randomly located obstacles of varying numbers and size then checked to find which edges in the PRM were less frequently used [27]. Once the edges of the PRM are trimmed down to a size which will fit to the programming of one edge per FPGA circuit, a limit of a few thousand, the FPGA can simultaneously accept the 3D location of a single pixel in a depth image and output a single bit to indicate if there is a collision with the pixels location which quickly leads to a collision-free PRM [27]. The robot can then pick the shortest path in the PRM. An example of one complex computation took just over 0.6 ms for the FPGA compared to 2,738 ms for a quad-core Intel Xeon 3.5 GHz processor.
Artificial Intelligence (AI)Figure 2 Google TPU [25]
New processors are being created to confront the processing requirements of AI machine-learning(ML) which uses deep neural networks (DNN) and deep learning (DL) for everything from voice recognition to self-driving cars [25]. AI will be used by robotic systems for improving vision, and kinematics as well. Google’s Tensor
Dissertation Exploring The Impacts Of Recession
Processing Unit (TPU), Intel’s Lake Crest, and Knupath’s Hermosa are examples from a few of the vendors intending to provide platforms targeting neural networks. The TPU has an 8 bit matrix multiply unit which optimizes DNN number crunching at a lean 700 MHz which outperforms CPU and GPU processing for DNNs with moderate energy, consuming 40 W of power (Figure 2 ) [25]. CPUs are usually 64-bit platforms and GPUs have wider word widths both optimized for larger data items whereas smaller 8-bit integers have found wide application in many DNN implementations [25]. The Intel Lake Crest is the code name for an Intel platform intended to complement the Xeon Phi which has been used for many AI tasks but found to be challenged by applications the Google TPU or Intel Lake Crest can easily perform with more efficiency [25]. The Lake Crest uses a
The purpose of this study is to explore the repercussions of recession on the British Stock Market particularly expounding its impact on Alternative Investment Market. The study aims to utilise qualitative approach to examine and constitute the relative repercussions of recession upon AIM. For this, an exhaustive literature review of the London Stock Exchange is essential to gain indicative factors relevant to account for the associated risks of recession to AIM. According to research on UK firms, uncertainty shocks typically reduce the responsiveness of firms by more than half, leaving monetary and fiscal policy-makers relatively powerless (Bloom et al, 2007).
1.1 LONDON STOCK EXCHANGE
LSE is amongst the oldest stock exchanges in Europe and also the most promising out of the 22 active stock exchanges functioning in Great Britain. It was established in 1801 and has emerged as the largest stock exchanges of the world comprising of number of overseas as well as British companies (London Stock Exchange, 2005). The positioning of London city is beneficial as it let the London Stock Exchange to function during American and Asian sessions. Being a public company its shares are traded on stock exchanges and is considered to be the most international trading floor and about 50% of international transactions with shares are concluded on LSE (London Stock Exchange, 2005). The London Stock Exchange has four main quarters that include equity markets which facilitates companies from across the globe to raise capital (London Stock Exchange, 2005).
There are the four primary markets that include: ‘The Main Market, Alternative Investment Market (AIM), Professional Securities Market (PSM) and Specialist Fund Market (SFM). London Stock Exchange is a highly active market that provides range of trading services including trading in a range of securities as for example, ‘UK and international equities, debt, covered warrants, exchange traded funds (ETFs), Exchange Traded Commodities (ETCs), REITs, fixed interest, contracts for difference (CFDs) and depositary receipts’ (London Stock Exchange, 2005). It provides market data information with clarity offering real-time prices, news and other financial information to the global financial community. EDX London, established in 2003serves as a major contributor to derivatives business in order to bring the cash equity and derivatives markets closer together the London Stock Exchange.
1.2 AIM: AN OVERVIEW
London Stock Exchange reviewed the unlisted securities market in1993 during the middle of a recession and decided to close it. Quoted Companies Alliance now referred as CISCO was then born and which lead to the establishment of Alternative Investment Market in June 1995 by London Stock Exchange. With its noticeable endurance for several years; AIM has been a considerable success. Rapid growth has been observed in AIM market, commencing its operation in 1995, it has rose over £24 billion and listed over 2,200 companies, including 276 foreign companies by January 2006 listing1,408 companies from 33 industrial sectors out of which 220 were from overseas countries. Instead of offering shares to the public AIM’s 90% of flotations depends on placing the shares with institutions, venture capital trusts and private investors reinforced by European 191 Prospectus Directive (Thronton, 2009). In order to reduce the pool of capital available to buy new AIM shares, the European 191 Prospectus Directive requires that, a full prospectus must be issued in both conditions where; the company offers shares to more than 100 persons, other than qualified investors or if a private client broker proffer such shares to more than 100 of their clients (Thronton, 2009)..
Based in the city of London, AIM benefits from competitive supply of leading financial services and decently offers direct access to outsized and sophisticated shareholders. AIM has the potential to provide with all the significant financial services as required by the firm for listing, floating, reporting, auditing, broking, public relations, security analysis, printing, legalities, registering shareholders, etc. Rising higher from a percentage of 35.2% in September 2003, the institutional investors owned 40.9% by value of the shares listed on AIM in September 2005(Growth Company Investor, 2005), that consequently accounts for a very substantial institutional contribution of AIM, in small-capitalization market.
1.2.1 MARKET SIZE
The multitude of companies traded on AIM come from different parts of the world and signify huge number of industries. At present there are approximately 1500 companies from more than 26 countries that are quoted on the AIM (London Stock Exchange, 2005). There is one common trait shared by all traded companies on AIM and i.e. a dynamic corporate attitude and a strong ambition for business expansion. AIM welcomes companies of varying sizes to become part of even though it was primarily designed for smaller firms, but companies of varying sizes if possessing a desire for growth and profitability, are equally encouraged to join the Alternative Investment Market.
1.2.2 OPERATIONS
The operations of AIM are controlled by the London Stock Exchange, having a tendency to work ideal for companies with a capitalization and valuation from $20 million to $300 million. The costs for filings and entry are approximately $600,000, with ongoing annual costs of around $100,000. The range of capital-raising activities tends to be in between $4 million to $40 million with approximately 9 percent average cost of capital. The percentage of retail investment is higher than on the official list and the investors are largely institutional.
1.2.3 KEY STATISTICS
Table: 01
AIM
1,635
UK
1,331
International
304
AIM Market Capitalisation
£94.4 Billion
AIM IPOs in 2006
278
UK
201
International
77
Capital raised since 1995*
£40.1 Billion
Capital raised in 2006*
£15.7 Billion
UK
£10.3 Billion
International
£5.4 Billion
* New listings and further capital raises
1.2.4 DIVERSITY AND INTERNATIONAL DIMENSION
AIM has a diverse market spanning (Figure, 02) in approximately 39 sectors having a number of international companies and investors. The AIM is comprised of key sectors in which there is resource sector that include mining and oil & gas, financial sector includes real estate, equity investment instruments and general financial. The industrial sector of AIM is comprise of construction & materials, electronic & electrical equipment and support services whereas, the consumer services includes media and travel & leisure. Apart from US the growth in international companies on AIM is also being driven through Canada, China, India and mainland Europe.
1.2.5 MARKET CAPITALISATION
According to LSE statistics the international companies listed as UK Top Co are counted as domestic. The US investors 330 international companies are listed with a value of £36.6bn equivalent to $73.5bn and over 70 US companies listed on AIM has a value of £2.9bn that is equivalent to $5.8bn (London Stock Exchange, 2005).
It is interesting to note that the international companies on AIM are larger than UK companies, with an average market capitalisation at 31 December 2007 of £99.2 million compared with £46.9 million for UK registered companies. The market capitalisation on Alternative Investment Market is expressed in the Figure, 03. It is important to signify that AIM is not subject to more extensive regulation and therefore, it offers a wider pool of investors, and this may result in some decline in the cost of capital (Errunza and Miller, 2000).
CHAPTER II LITERATURE REVIEW
2.1 INTRODUCTION
Establishing itself as the world’s most successful growth market after being launched by the London Stock Exchange (LSE) in 1995, AIM provides opportunity to raise capital and a liquid market place to trade shares for small and medium sized growing companies. Over 3000 small growth companies have listed on AIM and these companies have raised a total of over £60 billion, since the commencement of AIM. Global recession has caused complicated market conditions however; there are still some signs of recovery, such as the first major IPO of the year and on the other hand improvement can be observed in trading volumes and average; meanwhile, an improvement in fund raising conditions towards the end of 2009 and through 2010 is also predicted by the brokers and other market commentators (Thronton, 2009). In order to conserve its position in the market AIM has to become accustomed with current market conditions, ‘while not losing sight of its roots and emerge as a market focused on providing growing companies with direct access to capital’ (Thronton, 2009). The main objective of the literature review is to summarise the existing research work to gain insights on the subject area and also to assess and explain the impacts of recession. The core element of the research is to conduct an empirical study of the relative volatility, analysis of market size, allowance and liquidity ratios of AIM and determining its rate of progression during economic commotion.
2.2 AIM- FACTS AND FIGURES
The AIM’s trading began on 19 June 1995 and there were only 10 companies listed on the first day of trading. Since the opening of the Third Market in 1987, AIM was London’s first new market and it is split into two indices, the AIM 50 and AIM 100 Index where AIM 50 includes the biggest names on the junior market by attracting fresh, budding and newly expanding firms which were incapable for admittance to the main FTSE lists (London Stock Exchange, 2005). Even after facing criticism for the costs by some experts the market succeeded in making it easier for smaller businesses to raise capital. In accordance with the rules by AIM, the company’s costs rose up to 20 times higher in comparison to the earlier system. Notwithstanding the cost of raising capital was approximated to be an average of about £100,000 for an AIM company, as compared to £1m for a company on the main market (London Stock Exchange, 2005). There are now 1,276 AIM-listed companies. Liquidity among AIM stocks widely varies and the stocks having highest capitalisation and the largest free float represent comparable liquidity levels to the main market. There are a large number of illiquid stocks on the lower end of the market. AIM provides different trading platforms for different types of stock in order to improve the liquidity of the market but its volatility is not significantly diverse than other markets.
2.2.1 STOCK TRADING
Large and frequently traded stocks are listed on AIM and there are small, infrequently traded stocks also listed with it therefore; no single trading mechanism is applicable to AIM stocks. Considering the time from the institution of AIM, it has exhibited very rapid growth in trading volumes (London Stock Exchange, 2005) as represented in Table, 02. The average annual growth rates over the period of a decade starting from1996 to the year 2005 are as follows; the turnover was around 36%; number of trades was 28%; and the number of shares traded were 35% approximately. The average number of shares per trade grew by 5% per year, whereas the average value per trade grew by 6% per year, over this period. The growth of trading on AIM occurred in two phases. There was a substantial drop in stock market prices observed during 2001- 2002 where there was negative volume growth which gradually recovered in the year 2003 followed by rapid growth of trading.
2.2.2 UNDERSIZED REGULATORY LOAD
AIM regulations are designed to reduce burden for companies listing on this exchange. The admission process for AIM takes about three months, depending on circumstances (Audley, 2005) and in order to list on AIM;
There is no need for trading record and on the spot listing of start-ups and cash shells;
Smaller companies can also list as there is no minimum market capitalization;
Reduced costs and time for listing as the admission documents are not pre-vetted by AIM or the U.K. Listing Authority;
The lack of a minimum free float for preventing firms to sell off a substantial part of the business to list in AIM;
Approval from prior shareholder is not required for acquisitions that also reduces the time and cost of acquisitions.
There is an obligation to employ a Nomad at all times for each AIM-listed company. The Nomads carry out three main functions;
To make a decision that if a company should be admitted to AIM or not;
Managing the floatation process; and
Advice the company regarding rules, before and after it has been listed.
2.2.3 COSTS FOR LISTINGS
The admission fee of AIM is £4,180 with a listing fee of £4,180 per year and a value-added tax to these admission and annual fees is applied to UK companies. The total costs of admission to AIM are about £350,000 to £450,000 and a broker’s fees of 3% – 6% of any funds raised (Audley, 2005). Nomads are liable to undertake most of this process followed by any subsequent capital-raising and this keeps admission and listing costs under control.
The costs to the firm of listing on AIM include:
The initial costs to obtain the listing;
Followed by initial floatation’s costs of any subsequent capital raising; and
The annual costs of maintaining the listing.
2.2.4 THE MAIN MARKET
London Stock Exchange is one of the world’s leading stock exchanges and AIM offers a great deal of progression to it and vice versa. During a period of January 2000 to December 2004, a total of 160 companies switched between AIM and the main market. About 81% went from the main market to AIM and almost 19% went from AIM to the main market concluding that out of every company graduated from AIM to the main market, four moved in reverse course (Dufour, Sutcliffe and Wells 2005). In accordance with a survey (Baker Tilly, 2005b) 17 firms moved from the main market to AIM and their reason (Table, 03) for moving as constituted by the survey were;
Less regulation
53%
More Flexibility
41%
Less Expensive
24%
Tax Benefits
12%
Suitability
12%Table: 03
Furthermore, the survey (Baker Tilly 2005b) reveals that 64% of the main market companies considered moving in and back to AIM, out of which 26% actually
Design of Internet Service Application on WAP Device
planned to move whereas the rest of 34% companies considered it beneficial due to lack of provisional parameters, trouble-free acquisitions, greater flexibility and tax advantages.
2.2.5 TAXATION
The following areas of tax relief are available for individual investors in U.K. companies listed on AIM (Baker Tilly, 2005a):
The business asset taper relief tends to minimise the effective tax rate of capital gains tax up to 40% – 10%. In gift relief a capital gains tax is overdue until a subsequent disposal by the recipient.
Abstract
The ultimate aim of our project is to provide the design and development for an reliable internet service application which workable on the WAP enabled wireless handheld devices like mobile phone ,PDA(personal digital assistant) but mobile phone will focused mainly on this. To design a WAP application that will be usable by stock market user to receive and check related information like up-to-date stock value , stock quotes, as well as price detailed, trading status in the service directly from their mobile devices.
This project concern the developing, testing of a WAP based system for wireless handhelds devices like mobile phone to help the stock market user while on the move for instance the user can access to internet even when they travelling from geographical location to another . the idea of this application is to consider one that in principle not only delivering that data which involves in stock market updates and reliable and securely but one will be rapidly aware the user about the market changes in real time without even in the whilst in office or home , whilst we travelling , to the demand form of communication specially whilst “o the move”
The Stock Market system will be based on WAP architecture for mobile devices. This project will demonstrate how practical and possible will it be to use a mobile internet on the mobile phone to check the stock market value for a particular company whilst on the move. the user can have access to know the current price of the stock and it latest information
At click of the button without physically present in front of the stock market office or by watching Television at the someplace. The whole project framework is aim on to Create a WAP application which based on a server side application which could be the company to join a venture with the user’s to input the data to form a given result. And it important to aware of the modern days application are adapted by the user to improve their capabilities. According to the research board of project believe that the user application projects are lead to failure if it not fully obtain the user demands and requirement for particular needs.The possibly good market for such system will be investigated into further develop to refine a set of clients requirement . there will be a good response for such an application in the market which intended on user who has invested a solid amount in bonds , shares and gilts , and these are all designed to make life easier in such a way it enable the use to make decision at particular time to sell and buy stock such time .
1. Introduction
1.1 Brief
Stocks are considered riskier investments ,the value of a stock could at peak and drop down on the rate of the share by every time ,it completely depends on the situation of economy .for instance I am a stockholder having 500 share on a private company. Currently the value of my share is at good rate,and if I want to know what is market value of share with other company .Likewise most of the stock market holder are keen to know the latest information in real time .However it is only possible when the share holder are have a chance to watching news or log on a computer that they would be aware of the situation. Nowadays, most people on the move have at least one mobile device, a mobile phone or a PDA .so why not provide the stock market information as soon as possible directly on these mobile phones?.It can be either on a push basis or pull basis .push basis a like a push message it automatically send the latest information to the user whoever subscribe to the push service , in other hand pull message where the user have to send a request first to get the required response.
Most of the people nowadays having mobile phone along them and from which would the user also can access to the internet and other communication uses. Currently the mobile phones are very cheaper and popular in the market when we comparing with other kinds of electronic device However the mobile based stock market tracking system will allows the user to check the latest information of the stock value in the market.
There is good market scope for mobile communication due the feasibility and support of the communication at time . and other important of mobile internet is that a user can to be in up-to-date information on necessary thinks needed like weather , flash NEWS, email etc . this would be a viable alternative from traditional fixed internet for PC’s and implementation of the mobile internet which is very convenience for us.
Like Benjamin Franklin so rightly said, “Forewarned is forearmed”. So, on consumers’ point of view, yes, there is a potential need for this application. Moreover, most mobile phone network providers nowadays offer certain amount of free internet browsing on their mobile handsets each month. Users would prefer to use their free offer to check for stock information rather than dialling or texting a phone number, which are usually charged at premium rate, to get that same information. In terms of benefits for the stock exchange company, this will be an improvement of their customer service and keeping up-to-date with new technology. Staffs involved with providing information over the phone for those travellers who still feel at ease with that means, will be able to provide a better quality of service as he or she would not be under so much pressure of dealing with all the calls waiting in the queue. Moreover, staffs at the will fewer enquiries to deal with as commuters will be informed well in advance.
As author Ben Salter and Alex Michael mentioned .”thirteen per cent of mobile subscribes reported accessing news and information via a mobile browser in June 2004.” [ REF 1 ]
The both author believe that current number of user accessing the mobile internet to browser will increases in feature
1.2 Relevance to course Modules
The product based project are really challengeable to undertake but these are possible and manageable from the modules taught over the degree few of them are very help in understanding the cirtical part of the project. Some of the important module are helpful to this project are dicussed below.
1.2.1 CCM2418 (Digital and Mobile Systems) and CCM2420 Data Communications
These both modules are very useful and module which let me know about fundamental communication knowledge .we started with the simple data how it goes through different stage of process and to final point of the information at that level were we want know about web connection level what involves in modulation , demodulation , multiplexing and error checking
1.2.2 CCM3415 (Advanced Network Design and Security) and CCM2412 (Network Routing and Protocols)
In these both modules were important and necessary because most of the topics we learned were associated to computer networks, and it is contributed a very important role in this project , the areas have taught in these modules includes the fundamental of the network which OSI layer model . And another important area which is protocol on the network that are the set of rule govern the network . this was the whole set of the internet , which is the keen important to largest network
1.2.3 CCM3413 (Mobile Internet Applications and Services)
This was the module inspired and gave the knowledge to choose this project ,actually i learned the fundamental of the two-tier architecture , WAP technology , PHP , these topics are playing a main role in this project , module given a full scope of the internet and their uses in different device but we mainly focus on the Mobile Internet which inducted me to undertake this Project
1.2.4 CCM2426 (Professional Project Development)
In this module we learn how to work in group and make it as a team. We all worked together and put all our work in to one piece of report. And we learned business ethics and how to implement them in the real life and we have discussed about computer science ethics which some very important issues in the modern day computer field which includes legal issues , copyrights and piracy theses information areas will be more helpful when we starting the marketing and involved in the business related application then there we have to implement this strategies . in past few years piracy issues are increasing in a very dramatic way due the high speed internet available and this reflected on the computer business and they seeking for legal expect to avoid this kind of problem in future .
1.2.5 CCM3422 (Computer Communications Project)
This module has take place a major role of this project, according to the principle of Computer Communication Project, it involves in to scheduling and estimating technology
1.3 Literature Review
My project is consisting of many different numbers of components which performs in different step in its construction and completion. to get this project as one one working model or product ,it has to process through many tasks and topics. And each and every topic in this project are constantly analysis and studied so that all every aspect are fit and work as one whole product . This project are covered from different topics and areas that were research is been taken form many source which includes text books , online materials journals and past projects . some important resource are used for the research are mentioned below with reviews and definitions.
D.Houghand K. Zafar according to their point of view .there are millions of user subscribes to mobile network .these are include everyone from computer executive director to unskilled ordinary labour (Bale Bulb rook). With the benefits of the WAP enable mobile device such as mobile phones, Personal Digital Assistant (PDA ) and pager are developed to access the internet right on the mobile device able to access the phone banking , price checking , product purchase or sale , any sport result and much more
According to authors E.Evan ,P.Ashworth .the wireless device are increase in dramatic way and number of user to communicate , interact on the move, there is a survey showing that right now there is least One billion wireless are subscribes and soon will be increase to twice the amount now (P.Ashworth and E.Evans ,)
There are so many user are subscribe and using the WAP. With help of WAP people are getting the same usual format option as exactly From A personal Computer but these are depends on our convenience and so this will lead to big revolution of the internet in the mobile device and change the traditional way of accessing the internet .Eventually public will notice the real impact of WAP devices how it will change the way of accessing internet and they would know the benefits of using this technology , more user will subscribes to network and it will start to grow on numerous way on a new form of communication because it will start using the new will get start using the new technology and they will reply on the advantage ( Frerrel, ZOO )
In Karli Watson’s book (beginning WAP) . when we considering development of the today’s communication world some factors are comes first but wireless communication having big impact and revolution over the public and number of users are incredibly increasing at a dramatic amount of subscribing are using and amount of data interchanging in speed at which we access the business and another uses . In less than ten year time it will have a tremendous amount of development from initial level of the internet user from the traditional network
But there was a doubt on the factor of reliability and usability of the WAP access, On 2000 Ramsay and Neilson have noted in their book that the WAP is not really functional and popular now but it will be score a good reputation and developed system after 2001.Due to scale of operation grows it will led more difficulties observation.
To learning Unified model language (UML) introduce will helps and leads as work along with language focused in this book , the author help to keep the clear view on the UML language and help to protect in the cobwets of methodoly.
Fred R.Mcfadden and Jeffery A.Hoffer, , are interest on information resource management (IRM) are here to consider as normal way we do with everyday methods ,equipment . in other word the matter of information is a superior component and business resource and must has to treat as other asset such as student , things and etcs. Mcload and Brittain , are suggesting the basic ideas of IRM from their point of view
According Ian Summerville’s book is focused at student who undertaking the project in under graduation and graduate at software engineering . they have least know and done some fundamental engineering course such as programming languages . This book is full of general and basic idea of new update on some important topics such as , dependable system , requirement engineering, and architecture design.
1.4 Analysis from Literature Review
This application is to designed to track the Stock Market status report through WAP enable device . the idea of this application is to provide a service for the user to check their desirable company stock rate on the particular date and a response will send back to user using programmed database and techniques.
The main purpose for this application was to reducing time , developing the reliability and efficiency of use when comparing with current application or system .
According to the Ramsay and Neilson personal view of WAP and they believed that WAP had a very big impact on the today’s technology that we been using ever since it introduces of the this system in the market .it had a breakthrough with other opponent technology but it still had better critics among with other technology
P.Ashworth, E.Evans were best authors where keen to know about the feature of mobile communication , actually both were intended to show in their book , to tell what is the feature of M-commerce as of from this decades to next decades development opportunities. M-commerce is the combination of the traditional web system and the wireless connection,
Farrell were interested in studying the future of WAP technology to access the internet on mobile service and tried to explain the benefits of this system over people to use their mobile device to access the web browser or internet , even as our today’s live is becoming more amd more difficult by day after day so technology might have to help the problem with changing it same system or service for instance ,internet is access from system which through traditional network but would change it technology and developed into wireless internet that is possible by the WAP technology .
But according to Ian Somerville in their book Software Engineering ,they had a new form of ideas to develop and view a project by eight different parts which include an brief intro to software engineering , application designing , coding , validation and verifications , critical systems ,managements and software evaluation .this book also covers the system distribution architecture , and software development .the critical software system in consisted and integrated with the reliability , accessiably , security and avaliabilty so these are mentioned as a different topics.
Jeffery A. Hoofer and Fred R. McFadden in thier book Modern Database Management they were talked about the database in a larger sector how the larger context of information resource are stored and manage in a dedicated database .
In other hand Craig mentioning about the life cycle of the software and he says that UML depends on the different life cycle development model i.e. Spiral Model , Incremental Model and finally Waterfall Models , UML is depends upon the object oriented programming paradigm . so I am using one of the best model software life cycle model which Watetfall models.
2.1 Aims
The ultimate aim of this project to create and build a stock market quote that allows the user to quote the stock company and accessing these are all done by selecting appropriate option on the device to have a customer needs. And there will a database is designed for the data to processed from the user and they able to pass their won information.
2.2 Objectives
The objectives in project will be divided into two different informant categories ,in each category will further divided into subsection so that each and every phase will be individually discussed and this will lead to achieve a best possible end result of the Final product .
Design based objective:
Design based objective actually it involved in idea for framework the specified requirement for the user needs. It will really help the consumer and design from business prospect to achieve the best possible result . To build a system following key point must accomplished
- Modelling the system from requirement specification
- Implementing the requirement specification of the system using appropriate development tool
- Of course , testing ,evaluation and debugging the protocol against the system requirement .
- A created database will be use as a model for this project instead using the stock market databases
Research based objectives:
In order to give up- to- date software or system . we must have to be focus and to certain to changes will happened on the current system in terms in future development and challenges and often happened in the software industry.
There are some of important ways for getting the software awareness by following few steps
- By examining people who using the daily basis and observe main fact toward the stock market assessment involves by taking surveys and feedback on the web pages usability
- Offering alternative or current option available to stock exchange quote and their mentioning their advantage and drawback.
2.3 Software Life Cycle and Methodology for the Project
Software life cycle which related to our daily life process and it filters all process
over each and every stage in our life. It is pretty commonly known fact that relation pound exits between the product class and process quality is directly equal to the result of the Product is created . the software development is neither inevitable nor efficient to produce good piece of product ,but it is also very ease to keep your product as it is . A software life cycle for the project is model used to describes the phase or stage which a software development goes through . there is other way we can also describes a software life cycle models as “A software life cycle is vision of the perspective active that happens during software development “[REF 5] . these factors were helping us to understand and improve the basic characteristics and activities of the software life cycle
The software life cycle is best way to describe overall process involved in the project. Some important processes are described below.
- Help the project manager to keep the project on the track
- Describes the basic function that are excepted through the Project to per perform in period of software development
- Describes the major stage or phase of the software development
- Provides a general outlook od details tasks so that the we will know the every process involves in software development
This Project is development by the waterfall model. Waterfall model is method used for software development process ,it goes through serious of precious step by step method and process is looks as like as waterfall .The advantage of using the waterfall modal is we can organized ,chronological approach to software develop of our projects than beginning at system level and download to next steps .forward through software development in analysis, testing, coding and management . If the software is developed for large scale system so the effects need established for all system fundamental level and assign some division of particular tasks requirement through of software..
2.3.1 Waterfall Model:
Waterfall is commonly used and adopted in software development field . From the Waterfall Model the software development is very simple and straight forward.
The software development will simple as it iluustrated diagram and it says that will easier as ever before from any model . actually Waterfall model is designed to develop the software as simple method of order of segments as figure illustrated below, every segments and stage or phase are put into a distinct goals so that the any segments contributed to a software development are achieved successfully.
Software Requirement
In software development it is vital to gathering requirement of the software and analysis process is very important for a Software based project to build up and focus of the software .In order to know the nature of the program itself to built, one should understand and analysis the requirement of the software and domain need. To gather the requirement we have form and fellow a simple method with some of topic needed to clarified in order to get started this Project.
Design a software
Software designing naturally is a major and complex step process. To achieve a design process successful we have to interprets requirement into representation of the software. There so many reason and factor get the error on the software design.
Coding/ Programming
The designing a software which involves in varies of area to accomplished to form in machine-readable . so code generation is takes place in this step. In this step we actually test the code of our project.
System evaluation/Testing
Once the coding has done, the testing process begins. In this step it will point out any thing on the consist and logical parts of software to make suer which the given statements are correct and it have been tested. And another important part of test is function external testing and it is carried out to make sure that defined input statement will pass and produces actual result
Maintenance
Any changes or an error could happened. Once the Product has reached the end user which is the consumer . so it is important for a software to adopt into the real world use .the conditions of changes might happen on both side of the parties for instance If the consumer would like to change the option available on the current system by any chance. So it is vital for software development to maintain all the option and feature are must to be up-to-date
Project Management
Project management activities which involves in schedules ,planner, organization and creating tasks and document like Risk plan, SRS, configuration management and software development plan were produced .so for my Project i decides to use Work Breakdown System as project management
2.4 Work Breakdown System (WBS)
WBS is a break down system which is commonly used method in all computer project to achieve all tasks in the project to produce to one workable system. With help of this sort of methodology which help our project to on the right track . in our case to produce a WAP based system to stock market on the mobile devices.
3 Problem definitions
Someone who is travelling or is away from their workplace, it is often not possible to gain access from a fixed internet enabled device. But in home environment we would able to access to internet via the local network . Mobile devices are playing major in today’s communication world and it becoming very usual and common thing just seem for time. This seem like without this one might thing like a breakdown in the milestone of the telecommunication in this time . Good thing is almost all of latest mobile phones and devices are embedded with WAP-enable so this encourage the user to use this kind of services and the connection are made device by connecting to server which is provided by the network service provider, so therefore provide a service which keep market users, , who spend a proportion of their typical day in the process of accessing to the stock market and tracking on market , latest informed of stock variation, stock quotes, as well as price detailed, trading status, current company news & profile .
The big question is whether, there is a potential large scale need for such type of service by the stock market. Stock market information is not easily available perhaps unless you are make a phone request or log on to the Internet; and while on the move it is often very difficult to get internet access without a WAP enabled mobile phone or PDA.
It is quite simple to imagine that technology is backbone of today’s modern world, in this technology world the most important rule is played by the Software System. Almost everyone have to come across with the modern technology every day after day. But few technology development have made tremendous implement with presenting a new form of application performance , attached feature and way of interaction between the user and system these systems are really capable of do anything form a low- level basic need like TV remote to highly sophisacted and sensitive system like Bank transaction these all designed for one single purpose make life easier.
Wired communication systems have as their main disadvantage the lack of mobility; wireless systems have the big advantage of supporting mobility of system use.
In this modern world technology are getting even better ,not only in technology also in way of communication are now .The development of the mobile internet, mobile devices, applications and the provision of services such as the one proposed here attract considerable attention and effort in these time; there were number of studies and research going to find an efficient mobile internet for mobile phones and other wireless devices
One general requirement to ensure that the security of client there are variety of virus and attacker are waiting to corrupt or stole our data from us . so it important to guide the user to access the relevant information easy and rapid . there are two way for safe surf on the mobile internet
- Allow the user to surf the particular market report on the relevant web site on the micro-browser
- To allow data streaming to capture the information on the mamory
User interface is another issue in mobile device ,due it small screen it just display very few information in simple manner .
Brief product description:
- It is a client-server based application which will support multi-client. For example: User will input share company the which will be send as a request and the server should respond by sending the real time stock market value of the company share has traded over the previous 40 weeks
- It should be simple, with a suitable user interface and little user inputs so
Effect of Air Bags on Child Fatalities
that the result is obtained the as soon as possible
- It should also support push services, where certain stockholder will be automatically alerted on their mobile should any changes in the service status occurs. The server should automatically push the information to the specific registered mobile users.
Deliverables and Development Requirements
To successful completion of the project the following items in list will be given in the final submission
A hardcopy of the Project final report
Overview of the study
Evidence following the suggestions for age-appropriate restraints as well as stern seat locations for kids travelling in the motor vehicles has been fine established. Though, evidence for the age-based suggestions regarding air bags as well as kids is lacking. Even though the NHTSA course of action for kids as well as air bags have been circulated extensively, the age (or body size) that finest describe when a child’s additional danger of the injury or death from an air bag is replaced by benefit is unknown. Two initial studies suggested a link between air bags as well as childhood fatalities (defining kids as 0-12 years as well as 0-9 years of the age), but both analyses were limited by relatively small numbers of the fatalities, yielding statistically inconclusive results. Subsequent studies defined kids as 12 years of the age as well as provided more conclusive evidence for the link between air bags as well as death among right front seat passengers within this age range. Allison (2001) suggested that the increased mortality danger from air bags was most pronounced among right front seat passengers through age 10, becoming less pronounced from 11 to 14 years as well as turning to a net benefit for passengers 15 years of the age, but the results did not reach statistical significance. A more recent study examining differences in the air-bag effectiveness according to age as well as restraint use suggested a net increase in the danger of the death among child passengers 12 years of the age, but sample size limitations prevented definitive statements regarding the childhood age at net danger might change to no effect (or benefit) as well as the study did not assess markers of the body size. Durbin et al demonstrated that the danger of the injury (rather than death) among restrained kids 3 to 15 years of the age exposed to passenger air-bag deployment was twice that among front-seated kids not exposed to an air bag, with the danger of the injury being relatively constant among kids 3 to 8, 9 to 12, as well as 13 to 15 years of the age.
We hypothesized that specific cut-off points in the age, height, as well as/or weight among kids used to define when the danger of the serious injury from the presence of a passenger air-bag changes from harmful to no effect (or beneficial), after adjustment for crash severity as well as other important crash factors. We tested this hypothesis with age, height, as well as weight as effect modifiers (interaction terms) of the link between the presence of a passenger air bag as well as serious injury among right front seat passengers 0 to 18 years of the age that is involved in the motor vehicle crashes (MVCs).
Chapter Two: Literature Review
The Politics of the Air Bag Safety: A Competition among Problem Definitions
In light of the 121 deaths credited to the air bag deployments, considerably to children as well as adults of the small stature, recent policy debate has purposeful on altering present Federal automotive air bag regulations. A problem definition point of view is employ to identify the nature of this debate. (Ai & Norton 2003) Utilizing a content analysis of the executive record of the one U.S. House as well as two U. S. Senate hearings, it is quarrel that four problem definitions exemplify the debate over air bag safety: behavioural, regulatory, technological, as well as corporate greed. (Allison 2001)Furthermore, it is argued that a problem definition perspective offers a better illustration of the recent changes to Federal air bag regulations than do pluralist, elitist, as well as principal-agent models. (Association for the Advancement Automotive Medicine 2001)
Political discussion on policy issues are frequently portrayed as a disagreement over competing definitions of the social condition. (Braver & Ferguson 1997)A problem definition offers the frame through that present conditions are supposed to be in the conflict with treasured social values. In this way, policy issues are socially constructed as well as communicated through the articulation of the shared definitions. (Braver, Whitfield & Ferguson 1997)
Problem definitions are significant to policy theory in the two ways. First, they pressure that issues rise to the public agenda. Definitions delivers a frame through that social conditions are perceived to be problematic as well as in the need of the government action. (Braver & Whitfield 1998) Thus, the issues that are actively considered by government officials are in the part illustrated by the success of the definition competing for attention on a crowded agenda. (Barnard 1997)
Further than illumination that concern is on the public agenda, the problem definition viewpoint also can assist in illustrating the outcome of the policy process. “As political dialogue, the purpose of the problem definition is at once to give particulars, to explain, to advocate, as well as to persuade”.(Berg 2000) Actors participate to have their definition of the social state frame the nature of the policy discussion. (Cummings 2001) A problem definition clears the survival of the public problem as well as the causes that it exists. The usefulness of the specific solution reasonably flows from the espoused set of the causes. In this manner, policy entrepreneurs utilize problem definitions to taper the variety of the options under consideration as well as to espouse a particular solution. (Calvert & McCubbins 1989)
Therefore, problem definition “is often at the heart of the action itself,” argues Allison (2001). “A great deal of policymaking, in the fact, is preoccupied with whose definition would prevail” (p. 98).
Scholars have recognized a range of the characteristics that assist to illustrate the utility of the definition for structuring policy debate. In the hands of the accomplished policy entrepreneur, a problem definition, has possible solutions, as well as is well-matched with other definitions is a influential tool for influencing policy formation. Though, this position of the problem definitions has yet to be completely explored. (Cobb 1983)
The concern of the air bag security offers an opportunity to look at the role of the problem definitions in the policy procedure as well as to test propositions implicit in the previous research. Deaths that have been accredited to air bag deployments have purposeful attention on the dangers linked with air bags as well as have resulted in the challenge to the wisdom of the Federal regulation necessitate that they be fixed in the motor vehicles. (Corneli 2000) A number of problem definitions have emerged in the debate in the effort to influence Federal policy.
What are the mechanisms of the complete problem definition? What explanations are being used by policy entrepreneurs to persuade the substance of the government set of laws on air bags? Those definitions have been the most effective in the shaping new policy? Those definitions are likely to shape policy in the future? To deal with these questions we carry out a content analysis of the bureaucrat record of the three congressional hearings (two Senate, one House) held on the question of the air bag safety during 1996 as well as 1997. (Damsgaard 2001) The official statements as well as verbal remarks of the each contributor in the hearings were examined for the manner that the entity described (framed) the problem of the air bag safety. Also, present rules propagated by the National Highway Traffic Safety Administration (NHTSA) give out as the policy answer to this concern. (Allison 2001) To test hypotheses about the influence of the problem definitions on policy formulation, the content of NHTSA rules will be compared with the dominant problem definitions articulated in the debate as carried out in the congressional hearings. (Coughlin 1994)
Components of the Problem Definitions
Complete problem definitions have several key components. First, definitions recognize a societal state that needs to be remedied through government act. (Dahl 1967)Second, key statistics as well as descriptions of the relevant events are offered as evidence to empirically demonstrate the perceived condition. In offering specific empirical evidence a problem definition draws attention to certain aspects of the condition while strategically ignoring others. This evidence also has the effect of the demonstrating that the condition being described is not an isolated event. (Dahl 1982)The definition provides a frame through that the information is interpreted as well as may lead to a very different interpretation of the data gleaned from a different problem definition. Third, the causes of this condition are identified to allocate blame or provide an illustration. It is this open causal theory which frequently distinguishes a number of definitions. Fourth, a complete definition clears a set of the results that would answer the supposed condition. (Damsgaard 2001)
The solutions that are adopted reasonably follow from the articulated causal theory. Fifth, implicit in the reposed solutions is an acceptance of the key values or a desired end state. These values indicate what the condition should look like in the society. They also provide normative justification for the articulated causal theory as well as solutions. Sixth, to carry to life these values, symbols are used to perform the social condition that needs to be lectured. Symbols are substance that is gifted with importance that is not inbuilt in the entity itself that individuals use to sum up, condense, as well as simplify complex phenomena. (Decker 1984) Symbols not only help to converse other than it also builds understanding for a specific perspective. Entrepreneurs use symbols to persuade others to accept the basic assumptions of the problem definition. As Braver (1997) suggests, “symbolic representation is the essence of the problem definition in the politics” (p. 137).
Air Bag Safety Problem Definitions
In 1984, the U.S. Department of the Transportation needed that front seats in the motor vehicles be capable of with automatic occupant safety devices (i.e air bags) in its place of the, or in the accumulation to, physical lap as well as shoulder belts. In 1991, Congress focussed the NHTSA to adjust this standard to necessitate “an inflatable restraint” (i.e., air bag) when it passed the Intermodal Surface Transportation Efficiency Act (ISTEA) (P.L. 102-240). The Act required that air bags be put in the 95% of the cars by model year 1997 as well as in the 100% by model year 1998. Also, installation of the air bags was essential in the 80% of the light trucks in the model year 1998 as well as in the 100% by model year 1999. (Epidemiology 2002)
Earlier than air bags were completely installed in the automobile fleet as focussed under the ISTEA, deaths to small children as well as women of the small stature focused attention on the dangers associated with air bag use. The NHTSA has announced 121 deaths attributable to the deployment of the air bags since 1990. In some cases, these crashes happened at speeds so low that only slight injuries would have resulted had an air bag not deployed. (Glass 2000)In reaction, Congress held three hearings to deal with the dangers of the air bags, as well as the NHTSA has concerned four modifications to its regulations in an effort to overcome the probability of the future air bag deaths. Thus, current policy debate has focused on modifying present Federal air bag guidelines even before the ISTEA’s directive was completely put into practice. (Grisoni 2000)
Manufacturers have installed some of the advanced technologies that is needed to comply with the advanced air bag rule in certain vehicles that are on the market today. (See table 1.) Manufacturers and companies that produce air bags are working on the development of other needed advanced technologies, with the aim of having them ready for installation in vehicles by September 2003, as required.
Advanced air bag systems installed in future vehicles that are much more sophisticated than the conventional air bag systems in today’s vehicles, because they will be capable of tailoring air bag deployment to characteristics of the front seat occupants as well as crash severity. Conventional frontal air bag systems deploy the air bags with a single level of inflation output for all crashes that exceed a predetermined severity threshold. (Ai & Norton 2003)These systems generally consist of separate components designed to work together: crash sensors, a control module, and a driver and passenger inflator and air bag. The crash sensors and control module are typically located in one unit within the passenger compartment; the unit is often mounted within the floor between the driver and the passenger. (Allison 2001) The crash sensors detect the occurrence and severity of crashes and provide this input to the control module. The control module evaluates inputs from the sensors. If the control module determines that a crash has occurred that exceeds the severity threshold, it then sends a triggering signal to the inflators to deploy the air bags. (Association for the Advancement Automotive Medicine 2001)The inflators and air bags are packaged together in air bag modules, which are located in the steering wheel on the driver side and in the instrument panel on the passenger side. Upon receiving a triggering signal from the control module, inflators generate or release gases that rapidly fill the air bags, generally within 1/20 of a second after impact. The purpose of the inflated air bags is to provide protective cushioning between the occupants and the steering wheel, instrument panel, and windshield. However, the “single stage” inflators in most vehicles today, in some cases, provide more inflation power than necessary because they fill the air bags with one level of output when deployed, regardless of the types of occupants requiring protection or the degree of severity of the crash. (Braver & Ferguson 1997)
Future frontal air bag systems designed to meet the performance requirements of NHTSA’s advanced air bag rule may have additional features that will allow the deployment of the air bags to adapt to characteristics of the front seat occupants as well as different crash situations. Auto manufacturers anticipate that two new components may be needed to meet the rule’s requirements: occupant classification sensors and multistage inflators. (Braver 1998) Occupant classification sensors may provide an additional input to the control module to detect different types of occupants and whether or not they are belted. (Braver, Whitfield & Ferguson 1997) For example, manufacturers anticipate installing sensors that is able to identify whether the front passenger seat is occupied by an infant in a rear-facing child seat, a child, or an adult. (Braver & Whitfield 1998)Multistage inflators, which will replace single-stage inflators, may provide varying levels of inflation output that can be tailored to characteristics of the driver and front seat passenger as well as different crash scenarios. Deployment options could include no deployment, low-level output, and high-level output, as well as additional levels of deployment between the low- and high-output stages. (Epidemiology 2002)While the occupant classification sensors and multistage inflators are the key new features of the advanced air bag systems envisioned by auto manufacturers, other components may also be improved. (Barnard 1997)For example, manufacturers anticipate that these systems include crash sensors that can more precisely discriminate among different types of crashes (such as a crash into a rigid concrete wall versus a crash with another car), control modules that can process the additional inputs provided by crash and occupant sensors and make more accurate and timely deployment decisions, and air bag designs that allows the bag to deploy less aggressively. (Berg 2000) These advanced air bag systems are designed to reduce the likelihood of the types of fatalities previously caused by air bag deployments. For example, such systems would deactivate the passenger air bag or deploy it at a low level if the passenger seat is occupied by an infant or small child. (Cummings 2001) These systems may also adjust air bag deployment if the driver or passenger is a small adult. Some vehicles on the U.S. market today have frontal air bag systems with multistage inflators and some other advanced features, such as seat belt usage sensors and improved air bag designs. (Calvert & McCubbins 1989)However, no vehicles currently on the market have air bag systems with all the features manufacturers believe are needed to fulfil the requirements of the advanced air bag rule. In particular, no vehicles currently have frontal air bag systems with occupant classification sensors that can distinguish among child seats, children, or adults. (Cobb 1983)
Manufacturers plan to continue making improvements in existing technologies for crash sensors, control modules, inflators, and air bags to comply with the advanced air bag rule. Manufacturers and suppliers are working on improving the ability of crash sensing systems to differentiate levels of crash severity and types of crashes. As part of this effort, manufacturers plan to increase the use of multipoint crash sensing systems. (Corneli 2000)Manufacturers and suppliers are also developing more complex computational systems to be incorporated into control modules, in order to allow them to process the additional inputs in advanced air bag systems and to make accurate and timely decisions regarding deployment outputs. (Coughlin 1994)
Behavioral Definition
Under the behavioural definition, atmosphere bags are touted as a productive machine vehicle safety device. Federal regulations requiring the facility of atmosphere bags in the machine vehicle fleet have helped have American machine vehicles safer for occupants. (Dahl 1967)
To exemplify this perception, proponents of the behavioural definition offering estimates of the amount of lives that have been saved, and the amount of injuries that have been averted, by atmosphere bags. For instance, Dr. Ricardo Martinez (NHTSA) testified that “[a]s of April 15, 1997, much than 1,900 drivers and passengers are awake because of atmosphere bags. About 600 were saved in 1996 only. (Damsgaard 2001)
Deaths from atmosphere suitcase deployments are sad cases, and steps must be taken to guarantee that they do not happen in the future. But these deaths must be understood in the larger circumstance of traffic safety. (Damsgaard 2001)
It is significant to recall that over 40,000 folk perish in machine vehicle crashes each year. The deaths traceable to broadcast suitcase deployments are tiny in amount when compared with the amount of lives that have been protected by atmosphere bags. Senator Gorton stated that atmosphere bag-related “deaths are few in comparison with the amount of lives saved, or when compared to the 3,300 children killed in automobile accidents every year. (Decker 1984)In this manner the behavioural definition downplays the meaning of the deaths caused by atmosphere bags. The causal hypothesis for this definition suggests that the origin of the trouble is the conduct of the vehicle occupants themselves. (Epidemiology 2002)
Occupants are depicted as placing themselves at danger by positioning themselves overly tight to the atmosphere suitcase at the moment of deployment or by being improperly belted. In mention to the children who have died, Martinez stated: “Last year, about 721001121220f all the children who were killed in the frontal place [of] an auto were riding unbridled” (Glass 2000 p59)In most cases broadcast suitcase fatalities could well be averted by the appropriate consumption of place belts and placing inexperienced children in the back place off from atmosphere bags entirely. “[T]he behavioural issues, where, how, somebody sits, [are] ever going to be one of the principal determinants of living and death in the outcome of a wreck. (Grisoni 2000 p36) To exemplify the behavioural part of this matter, the place belt utilization pace of American machine vehicle passengers is compared with that experienced in new nations. Seat belt utilization rates in Canada and Australia are offered as benchmarks against which the U. S. experience is compared. (Ai & Norton 2003)
For example, Canada and Australia are credited with belt utilization rates of 90 0x0.002fb0804a29p-1022nd 95%, respectively; whereas the United States experiences a pace of 68. The correlation between belt consumption rates and atmosphere suitcase deaths is noted as Canada has had simply two or three fatalities attributed to broadcast suitcase deployments. If the conduct of machine vehicle occupants is causing the unfavourable consequences, so tools that change this conduct are the proper solutions. “In the brief condition, behavioural changes are the almost practical [cure] and would take the almost prompt welfare. Three tools to achieve a difference in conduct are “increased national training, improved resident security laws, and high-visibility enforcement of these laws. (Allison 2001 p44)
The values tacit in these behavioural solutions are general national safety, private obligation, and societal economical efficiency. (Association for the Advancement Automotive Medicine 2001)Because deaths happen in situations where the person is improperly situated or restrained, the person bears the obligation for altering the conduct that places them in risk. As Martinez testified: “No safety device is a cure-all; finally, drivers and passengers must go obligation for their own safety. To increase passionate consequence for these arguments, proponents provide respective depictions of the safety benefits of atmosphere bags. A woman is brought before a congressional hearing to say her tale about how an atmosphere suitcase saved her living. We a-e reminded that the lives saved are parents and grandparents. Videos indicate how atmosphere bags defend crash examination dummies in staged crashes. (Braver & Ferguson 1997 p128) In each lawsuit these symbols assist dramatize the technological and statistical arguments about the consequences of irresponsible conduct that induce the deaths traceable to broadcast suitcase deployment. (Braver, Whitfield & Ferguson 1997)
Regulatory Definition
Proponents of the restrictive definition admit the safety benefits of atmosphere bags, but the dangers of atmosphere bags are more outstanding than in the behavioural definition. The circumstance that is described is one where atmosphere bags make easily, but individuals are being injured and some die needlessly. To back this portrayal of the circumstance, statistics are cited that describe the amount of children and occupants who have died payable to broadcast suitcase deployments. But it is pointed away that insignificant injuries are the more popular outcome. (Braver & Whitfield 1998)
To exemplify the general potency of atmosphere bags, it is estimated that there have been over 1 million atmosphere suitcase deployments. In light of this whole amount, the industry is not putting away a faulty merchandise, but atmosphere bags surely can be improved. Also, it is noted that these deaths are occurring at a moment when Americans are buckling upward more now than always. Seat belt utilization rates are used to identify the circumstance but are interpreted in a distinct circumstance than under the behavioural definition. The reason of the circumstance is outdated and rigid regime rule. After describing the death of a 1-year-old daughter in his country, Senator Dirk Kempthorne characterized Federal rule as follows
Is Alexandra’s death a disaster? Yes. Is this disaster the outcome of regime rule? Yes. Is this rule killing children? Yes. It is argued that automotive manufacturers are required to play rigid regulations when designing atmosphere bags. In specific, Federal Motor Vehicle Safety Standard No. 208 is the principal perpetrator. This measure requires atmosphere bags to defend the median grownup male, who is unbelted, in a head-on wreck at 30 miles per minute. In light of statistics indicating that most Americans now “crumple upward,” the unbelted examination is outdated. (Barnard 1997) More significantly, to be in conformity with this rule. atmosphere bags must deploy at a personnel equivalent to 200 miles per minute. Such higher deployment forces are in surplus of what it would go to defend children and occupants wearing place belts, and still unbelted occupants.
Standard No. 208 is particularly unacceptable because by protecting individuals who in most cases are violating country place belt laws (i. e. , are unbelted), manufacturers know that they must put the older, tiny women, and particularly children at greater danger. As Senator Kempthorne comments: “[Standard no. 208] says, in gist, lawbreakers who do not don place belts will be protected. (Berg 2000 p67)But it may be at the price of your children. Not simply is there worry about the safety implications of Standard No. 208 but too the liability manufacturers may hold. “We think that manufacturers should not be subjected to merchandise liability danger when they are responding in better religion to a Federal authorization. (Cummings 2001)
The resolution that emanates from this causal hypothesis is an alteration in Federal rule. In the brief condition it is recommended that Standard No. 208 be amended to allow manufacturers to depower atmosphere bags (i. e. , cut the volatile accusation for deployment. Depowering would cut the danger that occupants confront when an atmosphere suitcase deploys. (Calvert & McCubbins 1989) Ultimately, the more suitable resolution is the liquidation of the unbelted examination entirely so manufacturers could produce a safer merchandise. (Cobb 1983) The security of the almost susceptible occupants in machine vehicles (i. e. , children, women of tiny height, and the older) is expressly espoused by this definition. Another value apparent in the proposed solutions is maker self-reliance or pattern flexibility. More tacit in this definition are values placed on legitimate conduct (i. e., wearing place belts) and the avoidance of maker merchandise liability. (Corneli 2000)
Tethered UAV Based Air Base Sense and Avoid Radar System
Common symbols engaged to produce sustain for this definition are susceptible infant passengers as well as outmoded, nonflexible regulation. Proponents of this definition let alone a direct critique of Federal regulators. As a substitute, their ire is determined on the regulation itself that is unfashionable or misguided. As this difference in symbols among the regulation as well as the regulator may seem minor, it allows sustained cooperation among the regulators as well as those espousing this regulatory definition. (Dahl 1967)
Technological Definition
The technological problem definition outlooks the state from the viewpoint of the
Tethered UAV Based
Air Base Sense and Avoid Radar System
Abstract
The future ability for commercial industry and private citizens to capitalize on the advantages of incorporating Unmanned Aerial Vehicles (UAV) into the National Airspace System (NAS) will require a safe and reliable air traffic control (ATC) system. The current NAS Air traffic control system requires manned control towers and “See and Avoid” capabilities to navigate under current regulations. The Federal Aviation Administration (FAA) is developing an UAV traffic management (UTM) system to support beyond line of sight UAV operation below 400 ft,. The unaffordability of developing a manned ATC system for small UAV’s is leading to the development of an UTM system that requires all operators to register their UAV, publish flight plans, and self-regulate the airspace. UTM’s success is based on all operators and aircraft participating, but airspace safety incidents from non-participating aircraft provides a foundation to investigate an alternative UTM solution. Evidence suggests employing a cost effective air based sense and avoid radar system over urban environments and high-density population zones areas can reliably identify participating aircraft, non-participating aircraft, and non-cooperative objects. The system will consist of a ground control station, tethered UAV, and Radar system. Utilizing the tethered UAV with the integrated radar payload will provide continuous operational data, prevent ground clutter interference and manage the transition from UTM to controlled airspace for safe operations. The tether will transmit ground power, command and control data to operate the UAV at a height of 400 ft., and transmit real-time radar tracks of all objects detected. Implementation of a powered to tethered UAV system with a radar payload will meet the “See and Avoid” requirements and allow beyond visual line of sight operation for the future.
Keywords: Tethered UAV, RADAR, UTM
Introduction
The growth of commercial and public traffic sectors has demonstrated a need for orderly and safe traffic management systems. The evolution of the automobile developed a need for rules of the road, roadways, and traffic signals. The advancement in the commercial and public aviation industry created a similar need for rules of the air, establishing airways, and the development of an air traffic control (ATC) system. The origins of ATC began with the Air Commerce Act of 1926, that provided the ability to enforce air traffic rules, require pilot licenses, and certification of aircraft, and continued with the creation of Federal aviation Act of 1958 that created the Federal Aviation Agency (FAA) (FAA, 2017). Over the last decade, the commercial, public, and defense industries have seen a tremendous growth in the development of unmanned aircraft systems (UAS) that are capable of being operated well beyond line of sight.
UAVs are available in fixed wing and mutli-rotor combinations that can accommodate a number of sensors and payloads at affordable costs. UAV operations, similar to manned aircraft, require the proper licensing, training, safety protocols, and must operate within visual line of sight (VLOS) for operation in the National Airspace System (NAS), but are difficult to enforce. FAA requirements under the small unmanned aircraft rule, part 107, require operations to be performed within VLOS of the remote pilot in command and the person manipulating the flight controls (FAA, 2016). The commercial and public sectors have demonstrated benefits for beyond visual line of sight (BVLOS) operation in low-altitude airspace at heights of 400 ft. above ground level and below to conduct deliveries, agriculture, mapping, photography, search and rescue, and disaster relief to highlight a few (Maryland Department of Commerce, 2015). The FAA estimates the small UAV hobby fleet will reach 3.55 million by 2021 and the commercial fleet will reach 0.422 million (FAA, 2017).
President Donald J. Trump directed U.S. Secretary of Transportation to develop a UAV Integration Pilot Program to safely test and validate advanced operations for drones in partnerships with state and local governments, that will result in the acceleration of safe integration of UAV into the NAS and realize the benefits of unmanned technology on our economy (U.S. Department of Transportation, 2017). Due to the large interest from Industry, private citizens, State and Local authorities, the FAA is developing a low altitude ATC system to safely accommodate all manned and unmanned aircraft, to include allowing BVLOS operations.
The FAA will need to develop the rules for the NAS for all operators, even those that are not trained aviators. UAV operations will only provide a safe NAS if all UAV operators participate in a low altitude ATC system. The expected growth in the UAV industry will lead to unsafe air transportation without additional technology. Developing a low altitude Radar that can quickly be deployed for localized ATC will be required.
Background
The FAA and National Aeronautics and Space Administration (NASA), with support from industry are developing an Unmanned Aircraft Systems Traffic Management (UTM) system that creates a regulated, self-identification, air traffic management system that supports real-time or near real-time airspace status between the FAA and operators in unregulated airspace (FAA, 2017). The UTM architecture is shown in Figure 1, which presents a strategy for all cooperative aircraft to function safely in the NAS.

Figure 1. NASA UTM architecture for low altitude airpsapce operations and control (Aweiss, Owens, Rios, Homola, & Mohlanbrink, 2018)
The UTM architecture is based on cooperative operators and has no ability to detect or see uncooperative aircraft or non-cooperative objects, such as towers or birds. The UTM system requires the UAV operator to file flight plans with a UAS Service Supplier (USS). The USS will validate and coordinate flight plans with other USS’s, the FAA, and supplemental data providers in real-time. If the USS receives no flight plan conflicts, it provides authority for the UAV operator to begin operations. The UAV operator has to provide real-time flight data to the USS, so it can share positon and intentions with other operators and the FAA.
The integration of the UTM system, as an ATC measure, provides awareness to all other participating aircraft. A future NAS with millions of cooperative and uncooperative UAV operating over urban environments could have a potential to cause catastrophic or fatal injuries due to mid-air collisions. Cooperative operators will have no way to see and avoid an uncooperative aircraft when flying beyond line of sight.
A study conducted by Virginia Tech, revealed a wide variation of injuries could be sustained from a small UAV to human impact, with data ranging from 10 percent to 70 percent of potentially severe neck and head injuries for drones weighing between 2.6 Lbs. and 24.2 Lbs. (Lillian, 2017). The risk associated with uncooperative aircraft causing human or property damage is too significant and requires additional technologies to be developed, for heavily congested airspace or urban environments.
Case Study
A case study of a black hawk helicopter damaged by a small UAV provides an example of how UTM, as the ATC alone, will not safely manage manned and unmanned aircraft in the NAS.
On September 21, 2017 a hobbyist, flying a small UAS under federal regulation Title 14 Part 101 at a height of 300ft, in normally allotted Class G airspace, collided with a Black Hawk helicopter that was flying under a temporary flight restriction. The UAS operator was found to be at fault for intentionally operating beyond visual line of sight and not checking for temporary flight restrictions, even though he was operating below 400 ft. (UAS Vision, 2017).
Analyzing this scenario, if an operational UTM system was in operation, the outcome may still have not been avoidable. If the operator was participating in the UTM system, the USS would not have allowed the operator to file a flight plan and provided warning that the airspace was under a temporary flight restriction. The operator would have not flown, preventing the mid-air collision. The operator could still chose to fly, but the flight data would be captured by the FAA and appropriate action could be taken by authorities. If the operator was unaware of FAA regulations or decided not to participate in the UTM system, a mid-air collision would occur, producing the same outcome. The observations from this case study, the commercial and civil growth of UAV operations, and the potential for severe human injuries led to a research question focused on addressing a cost effective “see and detect” technology for small UAV integration into the NAS:
RQ1: Is it possible to effectively use a tethered UAV integrated with a radar sensor to provide a 360 degree aerial view of cooperative and uncooperative small UAV below 400 ft.
RQ2: Is it possible to integrate the radar tracks into the UTM system, alerting the participating aircraft of the non-participating aircraft and non-participating objects location.
The need for an additional “see and detect” technology will be required to safely integrate UAVs into the NAS. The research question will investigate the available technology and the approach of using a tethered UAV with a Radar sensor to detect at a cylinder that is 10 km diameter and up to 400 ft. The research will investigate the design requirements, technology available, and the effectiveness of meeting these mission requirements.
The remainder of this research paper is structured as follows. A literature review will cover the research conducted into the theory of utilization of small tethered UAV and miniature radar system capabilities. Then a general overview of the system followed by the decomposition of design decisions for the three major subsections that consist of the ground station, the UAV, and the radar system. The next section will cover the limitations of each design. The command and control structure will be analyzed and it concludes with a discussion of results, the effectiveness of the solution, as well as areas of future research.
Literature Review
The first UAV was developed over a 100 years ago with a primary focus on military missions, but in 2009 the introduction of cost effective hobby grade small UAV at the Consumer Electronic Show led to the mass development for commercial and consumer UAV systems that were reliable and easy to fly systems (CraigI, 2015). The advancements in UAV system technology, since the market establishment of the market in 2009, has included autonomous flight control, auto take and landing, altitude hovering, object avoidance and a large number of payloads, from 4K motion video to commercial agriculture fertilizer systems (Joshi, 2017). The commercial and hobbyist UAV market is flooded with Group 1 lithium ion battery powered UAV’s that have limited flight time to 15 to 30 minutes, depending on the payload. Expansion of the UAV market to conduct extended flight times for commercial and military operations has created a market for low cost tethered UAV systems.
Tethered UAV’s provide long endurance high definition video for film and live events that provide a different view to the audience (Brown, 2018). Military operations have invested in tethered UAV’s to perform intelligence, surveillance, and reconnaissance (ISR), security, and overhead inspection that can operate up to 800 feet supporting payloads requirements of up to for 15 pounds and 1 kilowatt of power (Carey, 2016). Different approaches have analyzed methods of powering long endurance hovering UAVs by considering power over tethering and laser power beaming as methods of supplying constant power (Zikou, Papachristos, & Tzes, 2015; Achtelick, Stumpf, Gurdan, & Doth, 2011). Approaches to the power management system have considered both direct current and alternating current methods for applying power up the tether to limit the size and weight of the tether and power regulation.
Multiple models of the kinematics and dynamic flight control of a tethered UAV have been developed under conditions of a taught and dynamic tethers using Lagrangian mechanics to evaluate a stable altitude flight control (Lee, 2015; Nicotra, Naldi, & Garone, 2017). Several authors have researched methods for the winch, inside the ground control station, to control the tautness of the tether to maintain altitude and increase flight stability (Sandino, Bejar, Kondak, & Ollero, 2104; Zikou, Papachristos, & Tzes, 2015; Muttin, 2011). Utilizing a taught cable design has demonstrated advantages to controlling altitude and stabilization.
The radio aim detecting and ranging (Radar) sensor uses electromagnetic pulses that are reflected off from an aircraft and are unaffected by light, weather or clouds, to detect position and speed of the aircraft (Wolff, 2009). Miniaturized Doppler radar systems have been developed to provide an air based sense and avoid system for manned and large unmanned aircraft to meet the FAA requirements for a sense-and-avoid system that can detect aircraft and when required maneuver the UAV to maintain the required air space separation (Duffy, 2014). Utilizing an Air based radar system will reduce ground clutter that occurs from typical ground based radar systems, by detecting the airspace from above.
Operational Domain
The demand growth for UAV use in the NAS will require additional radar detection capabilities in the dense urban environments and areas of congested air traffic. According to Joshi, the commercial and hobbyists will utilize UAV’s for the operations listed in Table 1 (2017).
Table 1
Operations Conducted By Future UAV Operator Groups
Operations Hobbyists Commercial Government/Military Aerial photography/film X X First person control X Shipping and Delivery X X X Search and Rescue X X X Disaster relief X X X Infrastructure inspections X X Precision agriculture X X Law Enforcement X Storm tracking X X Traffic monitoring X X X Geographic mapping X X X (Joshi, 2017)
To maintain operational awareness and a safe NAS, the tether UAV system would be operated around airports, helipads or any areas with high manned aircraft traffic. The systems will also be utilized in dense urban environments, areas that have a high likelihood of uncooperative operators, and areas that limit ground based sense and avoid radar systems from detecting small UAV’s, due to terrain and buildings that can block or washout the radar signal.
System Users
The system will be utilized by state and local authorities or commercial USS services that provide authority over the airspace at 400 ft and below. Airport authorities would utilize this technology to protect approach routes where manned aircraft is crossing through the 400ft and ground level zone. Local authorities will want to provide protection to their citizens at large events, over crowds, or over schools. The system will be portable to support first responders for search and rescue or humanitarian aid/disaster relief operations to provide airspace traffic control where no UTM service or utilities are available.
Design Overview
The tethered UAV radar system will consist of a ground control system that provides the ability to control the deployment and operation of the UAV to perform radar detection of Small UAV’s in congested airspace. The ground station will supply constant power through shore power or by backup generator to the UAV allowing it to stay airborne unless extreme environmental conditions or needed maintenance ceases operations. The UAV will transmit the radar tracks through the tether to the ground control station where it will be transferred into the UTM architecture, allowing all cooperative UAV’s and manned aircraft to see the uncooperative aircraft. The ground control station is fitted with a transceiver to launch the UAV to any prescribed altitude of 400 ft or below. Environmental data will be transmitted through the UTM system allowing the system to automatically retract the UAV, if the conditions reach a set thresholds equal to the UAV’s performance capabilities.
Figure 2 provides a high level architectural design diagram of the entire system. The UAV will use open source and commercially available flight controls that have a demonstrated capability to hover at altitude, using GPS, accelerometers, and gyroscopes. The onboard computer processor will analyze the radar sensor data, capture the position data and transfer it at a rate of 1 Hz or greater into the UTM system. The UAV will include a battery backup system that will have enough power to allow the UAV to land safely if it detects power is lost from the tether. The ground control station will include an electric winch to control the tension on the cable that has the ability to retract the UAV at full thrust.

Figure 2. Proposed tethered UAV with integrated Radar sensor architectural design diagram
Design Decisions
Ground Station
The ground station will be the base for operations that will store, deploy, retract and operate the tethered UAV and radar sensor. The ground station will be integrated with a diagnostic feed to provide the operator feedback on the performance of the system during operation. The ground station is required to be portable, capable of being deployed quickly and capable of withstanding the environmental elements. The system needs to be man portable and fit through a standard 36 inch door so that it could be deployed from a roof top in urban environments. The ground station will be required to provide consistent power to the UAV through the tether, requiring an external power source of 240 V. The rest of the ground control station will consist of a winch system with tether cord, winch control system and transceiver system integrated with UTM.
The Ground station requires access to high speed data communications that can provide real-time radar tracks over Internet Protocol communication standards, required to feed data into the UTM architecture from the radar sensor. The ground station will receive local weather conditions and have external data inputs that can autonomously control the operating status of the tethered UAV system.
Winch System and Control
The winch system will maintain a constant tautness on the cable to help stabilize the UAV in flight and control the tether cable during ascents and descents of the UAV. A DC motor will be used to spool the cable drum with a current sensor in line to determine the amount of power being consumed. Morales-Perryman & Lee discovered by using a Porpotional-integral-derivative (PID) controller to read the current sensor data, the PID controller can modulate the voltage to the DC motor to control the taughtness of the cable (2013). Ohms law defines the relationship between current, I, in amps, the applied voltage, V, and the resistseance, R, in ohms.
I=VR
If R is consistent for a given electric motor design, then the torque will be directly porpotional to the voltage being supplied. The constant feedback loop will allow for smooth operation as the torque on the drum changes relative to the amount of cable spooled on the drum, the new weight of the tether and UAV and the enviromental conditons affecting the UAVflight perfromance.
The tether design requires a lightweight, robust cable that can support the loading encountered by the UAV flight dynamics, can pass power and data without any significant loss, and meet safe handling regulations. Controlling weight of the tether cable design is important to provide maximum payload lifting capacity and UAV flight stability. The tether is designed around the power requirements, which will be discussed in the power system. The tether cable will include two, LYNX-OEM-3P, Ethernet over power cable switches, removing the need for a separate data cable inside the tether cable (Atlanta Instrumentation and Measurement, LLC, 2015). Figure 3 shows the configuration of the power supply to vehicle utilizing the Ethernet over power switches with no requirement for an additional data cable. The switches are only 50 grams each, which provides additional payload capabilities for the UAV.

Power System
To provide unlimited flight time of the UAV, power is required to pass along the tether to the UAV. The UAV’s brushless electric motors operate on 24V or 48V DC power. For the electric motors to provide sufficient thrust at 24V DC voltages, the system will demand higher amps, that require larger gauge tether conductor wires to prevent excessive voltage drop and overheating of the cable at 400 ft. To solve the power problem, the UAV will utilize a known power (P) required to stay aloft, by increasing the voltage (V) the current (I) will be reduced by the following equation:
P=VI
The system requires the lightest and smallest cross sectional area tether to prevent increased loading from the wind, acting like a sail. The UAV minimum power required is defined by the amount of thrust needed for the system to hover. The power is defined by the overall system weight. The current can be reduced, requiring a smaller gauge wire, if the voltage is increased. Kiribayashi, Ashizawa, & Nagatani conducted a study that modeled and tested different optimal gauge tether wires to understand how the ressisance affected the power supply at the uav when fully extended (2015). They determined that a twisted pair of 20 American Wire Gauge (AWG) wires, with a denisty of 27.5 g/m, provided an optimal solution at 32 V and a height of 40m (Kiribayashi, Ashizawa, & Nagatani, 2015). To reach 400 ft. the weight of the cable would be approximatly 3.5 Kg utilizing a 32 V power system. According to a study by Kiribayashi, Yakushigawa, & Nagatani, they discovered increasing the voltage to 600 V DC would reduce the tether cable gauge and allow them to maintian 1200 Watts of power in the UAV (2017).
To maintain an acceptable thrust to weight ratio for flight stability and dynamics, The total thrust, T, should be twice the overall system weight, W (Selvaganapathy & Ilangumaran, 2017).
T=2W
The weight allotments for each of the subsystems are defined in the Table 2 and are used to define W.
Table 2
Weight Allotments for the UAV Tether System
Sub System Weight (Kg) UAV and Avionics 11 Radar Sensor 18 Power Converter 1 Camera .5 Tether (fully extended) 4.5 Total 35 The total thrust, Ttotal, is calculated at 70 Kg of thrust required for all electric motors. The total thurst per engine, Tengine, is calculated by
Tengine =
TtotalN
where, N, is the total number of engines on the UAV. Using a quad rotor design, Tengine, would require 17.5 Kg of thrust for each engine, that would require custom designed elcetric motors and propellers to support the system design. Using an octorotor design requires Tengine, to be 8.75 Kg thrust for each electric motor.
Analyzing commericially available motors, the KDE10218XF-105 fitted with 70 cm KDE-CF305-HP Hex rotor blade can geneate 9.8 Kg of thrust at 50 percent throttle, for Ttotal of 78.5 Kg (KDE Direct, 2018). This combination will require approximatly 600 Watts to hover and draw approximatly 20 Amps per motor.
The tether will supply 600 V at approximatly 4 amps, where it will be regulated to 48 V and 25 Amps to supply for the electric motors and radar power requirments (Russell & Mezin, 2016). According to Blattenberger, a 20 AWG wire capable of hadling 7.5 Amps, detailing a total teather weight of 3.5 Kg, fits in the alloted weight budget of 4.5 Kg and meets the desing requirments (2018).
Transceiver
The transceiver will allow for the transmission and receiving of data across the tether. The transceiver is required to transfer data at a minimum of 40 Mb/s to process the Doppler radar tracts (Echodyne Corp , 2017). The receiver will send the radar tracts across the local area network (LAN) to the IP based UTM network. The transceiver will have the capability to process full motion video from the UAVs onboard camera and transport over LAN to operators or optional recording devices at the ground control station.
UAV
The UAV will consist of the platform, integrated flight control, onboard processing, communication link, backup power source, and power conversion to maintain operation for extended periods. The UAV will be required to sustain flight at a height of 400ft. above ground level carrying the Radar payload, the backup power source, the power conversion, and the weight of the tether system. The system will utilize an integrated GPS sensor and IMU to control altitude and attitude stability during operations. The UAV on board processor will conduct sensor fusion of the GPS, IMU, and external inputs. The UAV will require both onboard battery backup power that is charged from the tether along with electrical control components to utilize the power being transferred from the tether.
UAV Design
The octo-rotor UAV design must consider the load and flight agility that will be required at 400 ft. above ground level. The UAV, radar payload, and tether will weigh 35Kg, with engines that have a capability of over 19.6 Kg of thrust at full throttle. The arm design must be capable of supporting 19.6 Kg of load and support the rotor blades that have a 77.5 cm (RL) tip to tip length. The octo-rotor design will consist of equally spaced arms every 45 degrees around the center body of the UAV. The arm length (AL) is calculated using trigonometry functions.
AL=12*RLSin 22.5=38.75Sin 22.5=
101.2 cm
The UAV will have a minimum arm length of 101.2 mm to prevent the blades from contacting during operation and require a 279.9 cm take-off and landing zone. Figure 4 provides the layout of the critical dimensions required to make the UAV design feasible for Radar payload mission.
The center hub of the UAV will house the flight controller, the processor, sensors, GPS antenna, power convertor, spare battery and radar payload. Using a radar design similar to the SHARPEYE – SXV, would require a set of retractable landing gear that provides a minimum of 58.5 cm X 26.2 cm of clearance under the UAV for takeoff and landing (Kelvin Hughes, 2014). Retracting the landing gear upon take-off prevents the landing gear from obscuring the Radar signals. The sketch in figure 4, highlights the design configuration. Figure 5 describes the design requirements to integrate the radar payload.

Figure 4. Octocopter UAV critical design requirements for 35Kg system


Figure 5. Octocopter Radar payload clearance requirements
Dronenerds. (Photographer). (2018) [digital image]. Retrieved from https://www.dronenerds.com/products/drones/enterprise-drones/spreadingwings/s1000s/s1000-a2.html
UAV Flight Control
The UAV will be integrated with a small stereo vision camera that can process images as a backup classifiyer to the Radar sensors. The camera will also be used to capture images of passing uncooperative aircraft or objects that could be used by enforcement officials to prosecute or train individuals on the importance of UAV safety.
The blades will be fitted on the, KDE10218XF-105, electric motors that can producte the required torque and thrust to support the UAV (KDE Direct, 2018). The UAV will use industry standard JST connectors to connect the GPS, IMU and retractable landing gear to the flight controller. The GPS antenna will mount on a mast, above the UAV, using U.FL RF connectors. The power connections will use industry standard XT60 connector from the power converter to the ESC controller and backup battery. A gigabit Ethernet connection using a cat6 cable will transfer data from the Radar Sensor to the onboard processor passing thru the tether to feed high speed track data to UTM.
The UAV, avionics, and camera will need to weigh less than 12.5 kg and incorporate a mount for the radar and connection for the tether. The system should be aerodynamically stable with eight rotors and 2:1 thrust to weight ratio. The system will be made of high strength, lightweight components like carbon fiber.
Radar System
The Radar system will consist of the Radar sensor, onboard processor, and self-diagnostic reporting. The Radar sensor is required to detect, track and identify participating aircraft, non-participating aircraft, and non-cooperative objects. UAV’s are capable of flying slow and their size can easily be mistaken for a bird, requiring for the Radar to classify the object.
Micro-Doppler radars, using the X-band frequency, can detect and classify rotating components along with the full body motion of the object, to determine the difference between UAVs and birds or fixed objects (Berroth, et al., 2014). The rotating array radar will operate in the 9.22 – 9.38 GHz range (Kelvin Hughes, 2014). Berroth et al., determined that rotating components of an object are detected by the radar as separate scatters, creating a distinctive Doppler frequency shift, that could be used to classify the UAV configuration (2014). The classifier would only have to detect a rotating blade to produce a track that could be used to notify the UTM system, as the UTM system doesn’t need to know the UAV specifics, just its location in the airspace. Figure 6 is a proposed model of the micro-Doppler Radar detecting the rotating blades of a UAV.

Figure 6. Radar system capturing micro-doppler frequency shift of rotating blade. (Berroth, et al., 2014)
The Radar software would remove the background scatter noise and align the Doppler frequency shift with the full body motion to extract the rotating features, which could then classify the UAV (Berroth, et al., 2014).
A continuous wave step radar, operating at 17 GHz, has also been used in short range test experiments to track the back scatter and determined a Doppler frequency shift created from UAV (Pieraccini & Miccinesi, 2017). The continuous wave step radar can systematically vary the transmitted frequency, instead of measuring the instantaneous rate-of-change, by measuring the time delay of the returned frequency reflected off the object in the airspace (Federation of American Scientists , 1998). The different radar frequencies provide options for different terrain and environments, where reflections and noise could be tuned out of the radars data.
The radars can detect approximately 5km and have a 120 degree field of view, with increased accuracy at closer distances (Kelvin Hughes, 2014). The Radar sensor would be able to cover the 400ft. and below requirement and provide warning to the cooperative aircraft of an object within a 10km diameter ring of operation. Multiple types of Radar sensor options and frequencies could package and meet the power requirements available in the tethered UAV.
Design Limitations
The system does have design limitations that could be possible to overcome with further technology advancements. The entire system will have operational limits due to environmental conditions. The system will be grounded during high winds, lightning storms, and extreme snow/icing events. Hobbyists and commercial UAVs would be limited or unable to perform in similar weather events, allowing these design limitations to be acceptable given the benefits to ATC.
Ground Control Station
The ground control station will require constant power that may not be available in the operational location and could rely on a generator to supply the power. If running off the generator, an individual would be required to monitor the fuel and performance of the generator every couple of hours. Alternative power studies could be performed to investigate using 240 V AC in the tether, utilizing a AC to DC convertor in the UAV. The design would need to investigate weight and thermal management concerns.
UAV
The overall weight and size of the system could limit the UAV from being mobile by a single person and provides more restrictions on the take-off and landing zone requirements. The UAV will also be classified as a Group 3, which is a UAV that weighs more than 55 lbs, requiring a Section 333 exemption from the FAA. (Federal Aviation Administration, 2017) (Abdullah, 2017).
The UAV will require thermal management of the heat generated by the DC to DC converter and the Radar. In extremely hot environments with little airflow around the system, the performance could be degraded. A heavier tether wire capable of supporting 48 V, which adds weight to the system, could be utilized to reduce from 600V to 48V in the tether, removing the need for the DC to DC converter and thermal stress on the system.
Radar System
Stabilized flight and attitude of the UAV is needed to maintain orientation of Radar sensor to collect the radar tracks. If the UAV attitude or hover altitude is unstable, the radar beam may not cover the ground level to 400 ft. of elevation, missing objects in the airspace. Integrating a gimbal to maintain stabilized orientation of the radar would provide a constant airspace picture, but the additional mass is currently not in the design budget. Converting the radar track position data using inverse kinematics to the UAV global Cartesian axes would provide a consistent 3D positioning of the tracked object as well, but would require additional algorithm and software development. The radar design limitations could be resolved with these solutions allowing for an increased level of position accuracy, tolerating closer air operations between systems.
Logic Design
UAV Control
The winch system will maintain a constant load on the tether as part of the UAV control theory, utilizing a constant force in the tether to maintain altitude and flight stability. In a study conducted by Nicotra, Naldi, and Garone, the UAV maintains hover control using a taut cable with an embedded loop control strategy based on a reference governor that can account for errors and maintain linear control (2017). Figure 7 highlights the embedded control logic for the UAV.
The ground control station will control the tautness on the tether, by calculating the current draw on the electric winch, allowing the UAV to optimize it’s flight control in heavy winds. The winch will increase torque on the motor not allowing more than 400 ft to be extended, working

in combination with the UAV flight control logic.Figure 7 UAV control logic for taut tether cable (Nicotra, Naldi, & Garone, 2017)
Radar Sensor and Track
Figure . State diagram of UTM operating with intruders or unknown objects being introduced to the airspace (Smith, et al., 2017)
The radar sensor will transmit the track data to UTM over an IP address using application programming interface (API) that is required to be a compliant with the USS. The APIs provide
the data format and transfer protocols to exchange data over the UTM servers (NASA , 2017). The UTM state diagram represented in Figure 8 shows how UTM will accept data as an intruder. The intruder data will be captured by the radar feed detecting the uncooperative aircraft and publishing the Radar tracks to UTM. UTM will publish the tracks to all aircraft in the area as a warning and allowing operators to redirect or land. UTM will disregard any radar tracks that correlate to participating aircraft.
The ground control station will transmit the radar tracks in the API format found in the open source USSREQ-API, allowing the USS suppliers to include the tracks in their shared airspace model (NASA , 2017). The USSREQ-API would use the code and data format found in Appendix A. Operators would receive the warning data, allowing the selection of manually or autonomous control of the UAV to take evasive action to avoid a collision.

Figure 8. UTM and radar track state logic for identifying an intruder (NASA , 2017)
Conclusion
The need for a low altitude Radar system that can detect uncooperative UAV and objects could provide a safe NAS for all operators of manned and unmanned Aircraft. The study revealed that a small UAV integrated with a micro-Doppler Radar system could be used to effectively to detect uncooperative aircraft using frequency shift of the blades to determine the object. The flight time and performance of the UAV would be limited, if operated off from battery power not making the system feasible. Utilizing a tether to supply constant power to the UAV and providing a mechanism for high speed radar track transfer creates a viable system. The size and power requirements of the system would make it portable, allowing operations to move to high air traffic locations. The solution developed in this research paper would provide an effective and efficient solution to RQ1.
The FAA is developing a UTM system that will coordinate and execute air traffic control at low altitudes. The UTM system provides APIs to receive Radar tracks for uncooperative aircraft and considers them intruders in the system. The tethered UAV onboard processor will provide the radar tracks of all aircraft detected and pass it over the tether to the UTM IP based servers. UTM APIs define the required protocol to accept the Radar tracks and publish them to all of the USS operations. This UAV tethered Radar system will answer RQ2 to effectively provide air space awareness to all manned and unmanned aircraft operators.
Future research would require Radar performance and tuning analysis based on the ground clutter and the background environment. An automated Radar tuning algorithm could be developed to provide the optimal settings on its initial take off, preventing the need for a qualified Radar operator during setup. Advanced tether materials could be examined to produce a lightweight tether design that would provide less drag on the UAV operating at full height.
References
Abdullah, Q. A. (2017). Geospatial applications of unmanned aerial systems (UAS). Retrieved from Pennsylvania State University: https://www.e-education.psu.edu/geog892/node/5
Achtelick, M., Stumpf, J., Gurdan, D., & Doth, K.-M. (2011). Design of a flexible high performance quadcopter platfrom braking the MAV endurance record with laser power beaming. Intelligent Robots and Systems (pp. 5166-5172). San Francisco: IEEE. doi:10.1109/IROS.2011.6094731
Atlanta Instrumentation and Measurement, LLC. (2015). Digital LYNX. Retrieved from Atlanta Instrumentation and Measurement, LLC: http://aimatlanta.com/wp-content/uploads/2015/04/LYNX-Connection-Diagram.png
Aweiss, A., Owens, B., Rios, J., Homola, J., & Mohlanbrink, C. (2018). Unmanned aircraft systems (UAS) traffic management (UTM) national campaign II. AIAA SciTech Forum (pp. 1-16). Kissimmee: National Aeronautics and Space Administartion. doi:10.2514/6.2018-1727
Berroth, M., Jacob, A. F., Schmidt, L.-P., Molchanov, P., Harmanny, R. I., de Wit, J. J., . . . Astola, J. (2014). Classification of small UAVs and birds by micro-doppler signatures. International Journal of Microwave and Wireless Technologies, 6(3-4), 435-444.
Blattenberger, K. (2018). Copper wire properties & gauge conversions. Retrieved from RF Cafe: http://www.rfcafe.com/references/electrical/wire-cu.htm
Brown, M. (2018, February 18). From tethered drone to cars that expand on a touch: daytona 500 tech for fOX sports. Retrieved from Forbes Web Site: https://www.forbes.com/sites/maurybrown/2018/02/18/from-tethered-drone-to-cars-that-expand-on-a-touch-daytona-500-tech-for-fox-sports/#7f50e7403cce
Carey, B. (2016, July 25). U.S. Army evaluates one of a new breed of tethered drones. Retrieved from Aviation International News Web Site: https://www.ainonline.com/aviation-news/defense/2016-07-25/us-army-evaluates-one-new-breed-tethered-drones
CraigI. (2015, August 21). The drone report 2016. Retrieved from Drone Flyers web site: https://www.droneflyers.com/the-drone-report-2016/
Dronenerds. (2018). Spreading wings S1000+ octocopter with A2 flight controller. Retrieved from Dronenerds Web Site: https://www.dronenerds.com/products/drones/enterprise-drones/spreadingwings/s1000s/s1000-a2.html
Duffy, S. M. (2014, October). Airborne sense and avoid radar panel. Retrieved from Massachusetts Institute of Technology Lincoln Laboratory: https://www.ll.mit.edu/publications/technotes/TechNote_ABSAAPanel.pdf
Echodyne Corp . (2017, June 26). MESA-DAA. Retrieved from Echodyne Corp Web Site: https://echodyne.com/wp-content/uploads/2017/08/MESA-DAA_Product_Sheet.pdf
FAA. (2017, August 15). FAA aerospace forecasts. Retrieved from Federal Aviation Administaration: https://www.faa.gov/data_research/aviation/aerospace_forecasts/media/Unmanned_Aircraft_Systems.pdf
FAA. (2017, May 16). Unmanned aircraft system traffic management (UTM). Retrieved from Federal Aviation Administration Web Site: https://www.faa.gov/uas/research/utm/
Federal Aviation Administartion. (2017, May 16). Unmanned aircraft system trafffic management (UTM). Retrieved from Federal Aviation Administration: https://www.faa.gov/uas/research/utm/
Federal Aviation Administration. (2017, November 24). Beyond the basics. Retrieved from Federal Aviation Administration Web Site: https://www.faa.gov/uas/beyond_the_basics/
Federation of American Scientists . (1998, January 20). Introduction to naval weapons engineering. Retrieved from Federation of American Scientists :
Analysis of Airbnb: Impact in the Lodging Industry
https://fas.org/man/dod-101/navy/docs/es310/cwradar/cwradar.htm
Hale, L., Denham, C., Mooney, R., Woolsey, C., Luxhoj, J., & Mancini, C. (2016). Assessing system safety for an urban, tethered UAS. 6TH AIAA AVIATION TECHNOLOGY, INTEGRATION, AND OPERATIONS CONFERENCE. Washington, D.C.: AIAA. doi:https://doi-org.ezproxy.libproxy.db.erau.edu/10.2514/6.2016-3595
Joshi, D. (2017, July 13). Exploring the latest drone technology for commercial, industrial and military drone uses. Retrieved from Buisness Insider: http://www.businessinsider.com/drone-technology-uses-2017-7
KDE Direct. (2018). KDE Direct XF M-R brushless performance testing. Retrieved
Analysis of Airbnb, the pioneer in the sharing economy, and its impact in the lodging industry
Abstract 200 words
Research Aim:
To evaluate and analyse the impact of Airbnb in the lodging sector.
Objectives:
- To determine and analyse the particular niche market which is focused the firm.
- To analyse the new trends in the lodging sector.
- To compare the growth between the company and the hotel industry.
- To compare the firm situation in different parts of the globe.
- To analyse the firm international business strategy.
- To create a new strategies and recommendations.
Introduction
“Belong anywhere”. With this slogan Airbnb has been able to make the members of its community having a sense of belonging, because the use of new technologies enables to bring people together, hosts and guests rather than isolating them (Chesky, 2014).
In the last decade, the rapid growth of the internet usage has had as a consequence the explosion of range and thickness of what has been named as sharing economy. (Lessig, 2008)
Internet has enabled people to collaborate in altogether new ways. From knowledge sharing websites to social media platforms that facilitate human relationships where people are sharing their time and skills by creating a virtual sharing community (Share The World’s Resources, 2012).
It is also known as peer-to -peer economy or collaborative consumption, which profitability is coming from the use of something that the users have in excess on behalf of someone else who needs its goods (Interian, 2016). This may be a lodging service by Airbnb, transport service which is provided by Uber or even used goods provided by Ebay, which are considered amongst the most important organisations within the sharing economy.
There are several factors that have to be considered on the growth of the sharing economy. These factors include the reduction of the ecological impact where waste is eliminated in a convenient and cost-efficient way (Interian, 2016), the social-economic conditions in the last decade which addressed the consumer to search better value for money and lastly the shift of users’ attitude towards ownership and the social connection needs (Chang, 2016).
Sharing economy has been affected by the internet’s design offering an enormous range of new opportunities. Differentiated from the commercial economy where the only thing that matters is the price, the sharing economy is regulated by a more complex social relations system. (Lessig, 2008).
Airbnb is an online peer-to-peer (P2P) corporation which is framed in the lodging industry. Its aim is to create a platform where (hosts) people who rent a bed in excess in their own property or offer the whole living space are meeting with the guest.(Interian, 2016) There are two main elements which are offered and experienced by the guest. The first and most important is the product features where tangible aspects are measured, such as number of rooms, size or location. The second element to take into consideration is the host attributes measuring intangible aspects such as fairness, responsiveness or hospitality. (Ert, Fleischer & Magen, 2016).
The company began as Airbed and Breakfast when the flatmates Brian Chesky and Joe Gebbia decided to provide airbed mattress with breakfast included from their living room as alternative accommodation in San Francisco in 2007. Next year, Airbedandbreakfast.com was launched when Nathan Blecharczyk joined the project, Shortly after the name changed to a shorter version that is currently well-known as Airbnb.com. Its international expansion started in 2011 with the opening of the first office in Hamburg. (Statista, 2016) Now, the organisation is operating in more than 34.000 cities in 191 different countries. In 2011 the firm had accounted 120.000 worldwide listings, the amount of listings has grown rapidly since then, accounting 2.5 million for 2016. The estimated revenue for 2015 was 900 million dollars with a forecast of 10 billion Dollars for 2020 and the most recent valuation of the company is about 30 billion dollars in 2016 (Southan, 2016). The organisation profitability is coming from the host who has a 3% commission of the lodge provided and on the second hand there is a fee in the range between 6% and 12.5% which the guest is charged as a reservation cost (Interian, 2016).
The rapid growth and expansion of the company might raise concerns from the hotel or lodging industry, where the possible impact caused in the sector would affect into the traditional hotel with a reduction of customers. This could be battled with price reductions, however triggering a decrease of the profitability.
Literature review
Hotel
The demand in the hotel industry depends on external and internal factors. Among the external factors is included factors such as economic instability (BREXIT, exchange rate), terrorist acts (Paris, Brussels..), Pandemics, (Zika virus). The internal factors in the hotel industry are considered aspects such as costs, which in the case of Airbnb are very low due to its specific features, other aspects considered are size, reputation or being member of a franchise and quality of service. It is considered that the hotel profitability is depending mostly on internal factors by 83% and the external factors influence in the profitability by 9%. Furthermore, is considered that the profitability of this sector depends highly on the sales variance provoked by variances in demand or the increment in supply (Aznar et al., 2017)
AIRBNB
Airbnb represents the sharing economy within the lodging or accommodation industry. Is it known for its community marketplace where the hosts and travellers can meet in order to offer or book respectively a large list of accommodations around the world. The organisation is operating in more than 34.000 cities in 191 different countries offering different types of rentals including houses, apartments and bedrooms. The Airbnb system allows the company to reduce considerably the costs, which makes the final price lower. The use of internet has helped to increase the participation in the community which includes different ranges of ages different cultural background and nationalities. The trust and transparency from the users is reinforced by reviews from both parts after the service. The firm is verifying the identity of the users previously.(Lee and Kim, 2017) These factors have helped to the growth of the firm globally. This rapid growth has to be taken into consideration by the industry, because an increase on the demand of this type of service might affect directly on the demand of the classic lodging market. However, the impact might be experience much more by lower-end hotels, than by high-end, business, and luxury hotels (Varma et al., 2016).
SHARING ECONOMY
The sharing economy emerged from what was called collaborative consumption. In the collaborative consumption the users can share, buy or rent different assets or services in order to reduce the cost or save money, in this specific case the host is renting a room in order to be able to pay mortgage and the hostage is saving money comparing with the hotel room.(Kim, Lee, Koo & Yang, 2017). Price is it not always the motivation to chose Airbnb because in some of the U.S. cities the price average is higher than the hotel accommodation (Liang, Choi and Joppe, 2017).Thanks to internet the sharing economy has gained more importance. In 2015, Sharing economy firms have provided about 60.000 jobs in U.S. Furthermore, it is forecasted that by 2025 the sharing economy will generate 335 billion of Dollars helped with the successful start-ups such as Uber, Ebay or Airbnb. This concept of business promotes the exchange of properties goods or skills between the users that are connected by internet via social media. The development of the smartphones has implemented the use and growth of this kind of companies (Liang, Choi and Joppe, 2017).
Innovation-technology
The term innovation refers to explore something new that previously not existed. A company is able to develop new processes, products or technologies. The innovations are classified in four types: behavioural, product, process and market innovation (Turulja and Bajgoric, 2016)
Innovation is a competitive advantage which is difficult to imitate or replicate. Airbnb has an innovative advantage comparing to the traditional hotel industry is creating a new market spaces, find new solutions for potential customers and creates a new business model (Lasserre, 2012).
The fast development in technology enables business to find innovative ways to attract potential clients; Uber is considered the largest in the world on its sector as well as Airbnb the largest lodging firm on the globe. These technology startups have changed the way to reach lodging or taxi services from the users. Now, the users have increased their choices with a more efficient and affordable system to book these services (Varma et al., 2016).
Millennials
A generation is considered to be all of the people of about the same age born and living within a society surrounded by the same political, economic, societal and cultural influences (Benckendorff, Moscardo & Pendergast, 2010). 1
Generation Y or Millennials refers to people born between 1977 and 1998 (Benckendorff, Moscardo & Pendergast, 2010) . 2
They are optimistic, confident, interactive and collaborative and also considered the most educated generation. The are digital experts as they tend to spend many hours in front of a screen and they form communities via the Internet as they grew up in an increasingly electronic world. Their characteristics are that they like to network and being team-oriented and they value travelling and experiencing events and places. In comparison with previous generations, the increased freedom to travel, the easy access to information and touristic opportunities and the low-cost carriers’ options have made travel more accessible for Millennials. Furthermore, the shift of the family values and the delay of marriage and kids have resulted in a higher number of singles travelling and a change of demand in the tourism sector. The Generation Y eased by the Internet and the technology focused society, consists the idea of a global digital community (Benckendorff, Moscardo & Pendergast, 2010) .3
It is considered the first global generation by experts, which are characterized by the search of authentic experience, to have more control of the activities, interest for new cultures and contact with the locals (ITB Berlin, 2016).
Many managers from the hotel industry view Airbnb as using a niche market, however many investors and analysts claim the opposite and anticipate interruptions within the sector, particularly by Millennials. (Varma et al., 2016)
The raised demand for shorter weekend breaks and the cheaper travelling options have increased the demand of city breaks. People tend to choose cities than the usual favourite destination, the summer beach holiday. People between 16-34 years old seem to prefer shorter breaks, and there is a tendency of 1-3 nights stay usually in a city. More specifically, 46% of vacationers went on a city break for holidays in comparison to 42% of people going to a beach destination in 2016. There is a growth of 8.6% to 43.2 million of the city break demand, whilst expenditure increased by 11.5% to £9.4 billion in 2016. (Mintel, 2017)
1 Millennials By Petra Glover
2 Millennials By Petra Glover
3 Getting to Know the Y Generation Donna Pendergast Griffith University, Gold Coast, Australia
Methodology
The methodology used will be a secondary research based on published journal papers, searched throughout Science Direct, EBSCOHost, which amongst others are the largest and with the higher reputation searching engines. The articles published in refereed academic journals will be the most relevant in the research. Outstanding online database will be updated, analysed and taken into consideration from Mintel, Estatista, Euromonitor or similar sources where the information is reliable and trustable as it comes from trades sources and national statistics. Industry reports will be considered in this research due to the difficulties presented by the firm, as Airbnb is not publishing its accounts and financial results is a private company and has not intention yet to go public (Reuters, 2017), which makes the process more laborious to find data and statistics from them. Prestigious and relevant magazines or newspapers like Financial Times will be also considered in order to maintain updated the information about the firm and the sector.
The methodology will follow a scientific or positive approach, where the results or outcome will be reached by analysing and gathering the information previously mentioned provided by secondary research sources.
The type of research undertaken for this project will be mostly a quantitative research, aiming to measure the impact of Airbnb in the lodging industry. In order to achieve it, large amount of data and statistics will be examined from relevant sources such Euromonitor or Statista.
In this project qualitative research will also be used, which will allow a better understanding of the sharing economy trends, mainly by looking at current and future customer behaviour trends. It will allow reaching other objectives of this project such as analyse the firm status in different countries worldwide or identify future opportunities that the market might offer. To obtain this information, referred academic journals, relevant magazines and the company website will be examined.
Relevant information has been collected from previous literature based on lodging rentals (Slee, 2017), where is found the number of listings of the last years provided by the firm in the main cities in western Europe, this data has been collected from the official website without logging in and will allow to determine the trend of the amount of listings offered in the website in different cities from western Europe. Furthermore, more relevant data has been collected from (Inside Airbnb, 2017), where is taken into consideration aspects such as the room type, availability and listings per host. These will allow to a better comprehension of how the hosts are using the internet platform in the different 10 cities in Europe.
In order to analyse the hotel industry trends, data from Barnes reports about the worldwide industry market has been considered where is seen the data since 2014 and forecasted to 2018 (Barnes, 2017).
Analysis
In order to analyse the trend of the firm in terms of listings data has been collected from the website tomslee.net. Different cities from Europe such as Amsterdam, Barcelona , Berlin, Copenhagen, Dublin Edinburgh, Lisbon, London, Madrid, Paris and Rome are included in this study where it is seen the number of listings per city from 2013 to 2017. Most of these cities do not have the updated data for 2013, this might have two explanations: Airbnb was not established in these cities in 2013 or the author of the data collection did not take them into account (Slee, 2017).
city/year 2013 2014 2015 2016 2017 Amsterdam 5645 7693 13360 16592 Barcelona 10441 12467 17154 17269 Berlin 7789 11553 16135 18473 Copenhagen 7884 8248 17852 Dublin 3625 6473 Edinburgh 1127 1689 4571 7129 Lisbon 5652 8968 11792 London 13054 13237 21298 34414 53947 Madrid 7490 5393 12615 Paris 19004 19946 31341 55951 61666 Rome 1714 7810 15703 17900 25226 As it is seen, that all the cities have doubled the amount of listings from 2015 to the beginning of 2017 which is the most updated data. It is also seen clearly which are the cities that offer more accommodation in Airbnb. These are Paris and London with 61,666 and 53,947 listings respectively. It is also seen that Dublin and Edinburgh are the cities with less listings available with 6,473 and 7,129 respectively (Slee, 2017).

The rest of the cities have an average of 18.000 listings available, being Rome over the average with about 25,000 listings, the capital of Italy (Slee, 2017).
Data collected from insideairbnb.com has been considered for a deeper analysis of how is Airbnb’s situation of the previous listings offered, Lisbon and Rome have been discarded for the study due to the lack of information available for the respective cities in this website. Relevant data has been considered such as the type of lodging offered which it can be the entire apartment, a room or a shared room. Activity refers to the average of nights per year that the listing is actually being used. High availability refers to the average of listings that are over the maximum allowed by law or by the terms and conditions of the website agreement. Multi-listings are referred to the average of hosts that are offering more than one accommodation through the firm. Maximum days per year are referred to the maximum of days that can be rented a listing per year according to the city-country legislation system. This data is not fixed and is varying depending on the particular law of the location (Inside Airbnb, 2017).
cities apartment room shared room activity high availability multi-listings hosts Max. days/year Amsterdam 80,60% 18,80% 0,50% 96 51,60% 24,60% 60 days Barcelona 50,40% 48,40% 1,20% 99 71,70% 57,50% 90 days Berlin 60,70% 38% 1,30% 121 73% 26% 90 days Copenhagen 80% 19,50% 0,50% 58 46,30% 12,20% 60 days Dublin 47% 50,30% 2,70% 98 49,90% 43,80% 90 days Edinburgh 54,70% 44,40% 0,90% 82 63,60% 43,80% 60 days Lisbon London 51,20% 47,30% 1,40% 89 58,80% 40,90% 90 days Madrid 60,20% 38% 1,80% 99 73,80% 52% 90 days Paris 85,70% 13,30% 1% 91 53,60% 20,80% 120 days Rome As it is shown in the table, in the majority of the cities, the listings offered in the website are composed mostly by entire homes , only Dublin is offering less than 50 per cent of its listings, the rest of the cities have more than 50 per cent. In the table it is shown the cities that are offering mostly a room instead of a whole property, among them are Barcelona, Dublin, Edinburgh and London. Furthermore, the table shows that the shared room listings offered in the website represent about 1 per cent in all the cities (Inside Airbnb, 2017).
The table shows that the average activity per listing is slightly above of the maximum allowed by law. Berlin with 121 average nights per year is the city that has the most availability per listing. On the other hand, Copenhagen is the city that has less activity per listing being below of the maximum allowed in the city with 58 nights per year.
Looking at the high availability data, it is shown in the table that the cities listings are being used over the maximum allowed by 46 per cent or more, being Copenhagen with 46.3% the lowest and Madrid and Berlin the highest with 73.8% and 73% respectively.
Lastly, as it is seen in the table, there is a considerable amount of hosts that have multi-listings on Airbnb, Copenhagen is the lowest with 12.2% and Barcelona is the highest with more than 57 per cent (Inside Airbnb, 2017).
In order to understand the size of Airbnb and compare it with the most prestigious hotel chains, the amount of rooms or listings being offered has been ranked by STR.
Airbnb had at the beginning of 2016 about 3 millions of listings/rooms worldwide. Almost three times more than Marriott International that was the second of the largest lodging companies in the world. The rest of the hotel chain do not offer even a third of what is Airbnb offering around the world (STR, 2017).

In order to understand the hospitality industry trends from the previous mentioned European cities, has been taken into consideration the trends of the respective countries which has been collected by Barnes in a 2017 industry report. The tables are collecting data from 2014 and forecasting 2017 and 2018 with the number of establishments and the sales, where it is seen the percentage of growth year to year (Barnes, 2017).
Netherlands has decreased the number of establishments from 2014 to 2017 by 97, from 3,297 to 3200 respectively, it is estimated that for the year 2018 the number of establishments will increase by 10. On the other hand, the table shows that the sales from 2014 to 2017 has increased from 7,729 millions to 8,080 millions respectively, which represents a growth average of about 1.5% per year, it is estimated that for 2018 will increase at the same level 1.6% (Barnes, 2017).
NETHERLANDS

Spain has decreased the number of establishments from 2014 to 2016, by 70. However on 2017 has increased by 112 and estimating for the next year a 1.5% growth. On the other hand, the table shows that the sales growth is low with an average of 0.2% since 2014 and estimating for 2018 a growth of about 0.3% (Barnes, 2017).
SPAIN

Germany’s number ofestablishments has been reduced from 2014 to 2017 from 15,918 to 15,126 and it is expected to reduce more for 2018 with an average of -0.4%. However, sales has suffered an increment average of about 2.5% between the years 2014 and 2017, being predicted for 2018 a steady increase of 2.5% of the sales (Barnes, 2017).
GERMANY

The number of establishments in Denmark has declined from 2014 to 2017 in 31 units, from 1,105 to 1,074 and it is estimated a slightly increase of 0.3% for 2018. However, the table shows that the sales has increased in about 2.5% from 2014 to 2017 being expected an steady increase of 2.5% for the next year (Barnes, 2017).
DENMARK

Ireland’s number of establishments has been increased from 2014 to 2017 from 1,163 to 1,192 and it is expected to increase more for 2018 with an average rate of 2.2%. On the other hand, the sales have also increased by 3.2% average from 2014 to 2017, and has been predicted for 2018 an increase of 3.3% (Barnes, 2017).
IRELAND

.
The number of establishments in United Kingdom has declined from 2014 to 2017 in 264 units, from 12,645 to 12,381 and it is estimated an increase of 0.6% for 2018. However, the table shows that the sales have increased in about 4% for the same period being expected an increment of 4.1% for the following year (Barnes, 2017).
UNITED KINGDOM

France’s number of units has been reduced from 2014 to 2017 from 12,104 to 11,882 and it is estimated a change in the trend for 2018, increasing by 0.7% the establishments. However, in terms of sales it is seen in the table that has increment the sales ratio for the same period in about 2.5% average. It is estimated an increase of the sales for 2018 by 2.7% (Barnes, 2017).
FRANCE

Overall, it is seen in the tables that the general trend of the number of establishments is descending with the only exception of Ireland that shows a positive trend. The majority of the countries have forecasted for 2018 an increase of units, except Germany which will decrease. However, as it is shown in the tables the general sales trend is positive between 2% and 4% of for the last three years, excepting Spain which has very low sales ratio. Generally, the sales ratio for the next year is expected to be positive (Barnes, 2017).
CBRE Hotels report information has been considered in the United States Lodging industry due to its reputation within the sector. In the report information has been selected from U.S. and compared different types of rates between Airbnb and the traditional lodging industry trying to measure the risk for the hotels, this report covered 59 cities including 229 submarkets in U.S. (CBRE Hotels, 2016).
The chart shows the share of demand that Airbnb is taking from the hotel industry in United States from October 2014 to September 2015 which increased by 0.8% from about 1% to almost reach 2% of the hotel market share. It is showing a peaks in December and August where it is most likely the increment of the demand due to the holidaymakers season (CBRE Hotels, 2016).

Morgan Stanley research analysed the share of demand that Airbnb is taking from the hotel industry in United States and Europe from 2015 to 2018. It is seen in the chart the share of demand that Airbnb was taking in 2015, and the estimated for 2016, 2017 and 2018, it is expected to have a 6% of the hotel demand share for 2018 with a trend that seems to grow by 1% per year (Ting, 2017).

The World Travel Monitor Forum which gathers 50 global experts from Europe, Asia and America, in representation of international and national tourism firms and associations, and companies from the private sector, has discussed about the sharing lodging providers and the experts calculations from Europe users in 2015 trips is that are represented by 3% of the demand. This data is similar to the previously provided by Morgan Stanley but considering also United States in their calculations (ITB Berlin, 2016).
In order to study the consumer behaviour of the Airbnb users a survey was made by AlphaWise in 2015. The survey was made to 4,116 persons over 18 years old in United States, Germany, France and United Kingdom. A relevant question for the case study was made; the the survey asked which was the accommodation that Airbnb users have replaced. The questionnaire also estimated the intention of the users for the next year 2016. Alphawise estimated that its results have a 90% level of confidence, with a 3% of margin of error (Morgan Stanley, 2015).
The results of this specific question from the survey are represented in the following graph, it is seen that the users of Airbnb are replacing by 42% the traditional hotel in 2015, increasing by 5% for the next year. According to the graph it is representative that most of the demand is coming from the traditional hotel industry and it is estimated to increase the numbers of Airbnb users that replace the hotel (Morgan Stanley, 2015).

AlphaWise on its survey made another relevant question to understand the Airbnb user and its trends, the questionnaire asked about leisure and business users of airbnb in 2015 and their intention for 2016. It is seen in the graph that for both business and leisure the percentage of users was 12%, increasing both for the next year being leisure the top choice with 18%. A further study made by Morgan Stanley that can be also seen in the graph, revealed that the average for leisure and business for 2016 was even higher than Alphawise predicted being 19% and 18% respectively. Morgan Stanley is estimating for the year 2017 a significant growth for both, with a forecast of 25% for leisure and 23% for business (Ting, 2017).

Airbnb around the world has been analysed by Euromonitor collecting data from 2012 to 2015 and being compared with relevant competitors such as intermediaries, short-term rentals and hotels. It is seen in the graph that it is compared Airbnb with competitors in terms of Compound Annual Growth Rate (CAGR), The firm trend is downwards from 2012 to 2015, but has 50% CAGR in 2015 while hotels CAGR trend is downwards too but reaching a negative average for 2015 of about -5% (Euromonitor international, 2016).

In the Euromonitor analysis has been evaluated a growth ratio comparing different areas of the globe such as Eastern Europe, Asia pacific, Latin America, Western Europe, MEA, Australasia, North America from 2009 to 2015. The Graph shows that the Growth ratio has been reduced through the years reaching 40% in 2015. It is seen clearly that Western Europe and North America are the areas were Airbnb is more dominant in the world and has had more impact, representing these two areas more than a half of this growth (Euromonitor international, 2016).


Eurominitor
New_Global_Briefing_The_Sharing_Economy_in_Lodging
A survey made by Phocuswright in 2014 has been considered to a deeper understanding of the sharing economy accommodation users. The survey has included a total of 8,045 individuals which are 18 years and older and have a travel experience within the last year. The questionnaire has been answered by individuals from different countries around the world including United States, United Kingdom, France, Germany, Australia, Brazil, Russia and China. The respondents have been ranged by groups’ ages, more specifically three, millennial from 18 to 34 and then two more groups, from 35 to 54 and more than 55. It is shown in the graph that the group of millennials is higher or equal to the other groups in all countries. In Germany, millennials represented by 40% is the lowest by country, and In China it is considerably superior to the rest of groups by 73% (Statista, 2016).

However, an analysis by Euromonitor in 2016 of the sharing economy in lodging counted about 25% of the world population as Millennials which is a great market. And reveals that Airbnb users average age has been incremented, establishing the average user in around 35 years (Euromonitor international, 2016).
Results
The data obtained from listings offered in Airbnb from European capitals are represented in the Figure 1 and 2. The number of listings on these cities have been doubled or tripled, in many cases showing the market penetration of the firm in these locations. Increasing rapidly the supply the platform becomes more competitive within the sector and enhances the brand itself. The cities where the brand has entered easier and with highest endorsement are London and Paris; in these cities the number of listings is double or more comparing with the rest. It is considered that an increase in the supply of Airbnb accommodations affects directly to the sector because the profitability depends on variations of revenues which are caused by increment in supply or changes in demand (Aznar et al., 2017).
The characteristics of the listings from Europe sampled were analysed as it is shown in the Figure 3 in order to have a deeper knowledge. It is clear by the sample that most of the listings offered in these cities are the entire apartment, in some of these cities reaching 80%. However, the listings offered as room or shared room is less significant representing between 50% and 20% depending on the city. It is shown that overall many host posted more than one property between 12% and 57% of the hosts of the European cities. Furthermore, it is shown that most of the hosts rent the property for more days than the maximum allowed; the law varies depending on the city that is going from 60 or 90 days with the exception of Paris which is 120 days (O’Sullivan, 2016). More than 50% of the listings have been rented for more days than the maximum permitted. This host profile is far from the one that initially had in mind the company when it was founded. The idea was to share a room or a bed from the host property in order that the guest could live like a local. The host aim was be part of the community taking an extra income to help pay mortgage, home repairs or have a dream trip (Airbnb.co.uk, 2017). It is clear the misuse of the platform by more than a half of the users of this sample which might use the platform in order to hide a lodging business avoiding the payment of different taxes, increasing the profitability of each property thanks to the tax avoidance. This has been seen in the most important investigation case of Airbnb where it was demonstrated that about 70% of the transactions under the investigation were not legal considering the law in that specific year and the impact on the economy of the cities by losing the tax revenue (Varma et al., 2016). The Figure 4 shows the rooms or accommodations supplied by Airbnb in comparison with the most prestigious hotel chains around the world, it is clear that the Airbnb supply is almost three times superior than Marriott which is another indication of the organisation growth. An increase of 10% in the Airbnb listings is related to a 0.37% reduction in the hotel room revenue, moreover, it is considered that the Hotels which suffer stronger impact are the ones with low category (Guttentag and Smith, 2017).
The traditional hotel sector has been analysed in terms of number of establishments which determines the supply, and the sales from 2014 to 2018 in different European countries. In the Figures 5 to 11 it is shown that all the countries have reduced the number of establishments with the exception of Ireland which has barely increased for these years. This could be related to the lower supply by Airbnb for this destination which it is shown in the Figure 1 that Dublin has the lowest amount of listings from the list. However, looking at the sales it is shown that all the countries have had an steady growth between 1% and 4% this might be related to the increase of occupation levels at hotels being more efficient. Hotel sales growth is related by experts to the GDP growth which is between 3% and 4% for the same period is expected that if the level of income increases, will increase thus the amount of people travelling and hotel stays (Euromonitor, 2015).
CBR Hotels report of about 59 cities in United States in 2015 indicated that the share demand of Airbnb represented almost 2% of the Hotel industry demand as it is shown in the Figure 12. Furthermore, a deeper analysis made by Stanley Morgan which considers in the study Europe and United States indicates that the demand of Airbnb was 2% for 2015 and estimating a growth of about 1% per year seen in the Figure 13. Lastly, In the World Travel Monitor forum which includes tourism experts and professionals of the sector from the world reached the conclusion that Airbnb represented 3% of the demand of the hotel industry in 2015. All this results have been obtained from different experts and considering different areas of the world, the first considering U.S, the second added Europe and the third added the rest areas of the globe ending with a similar average of the demand that Airbnb represent of the hotel industry.
REFERENCES
Airbnb.co.uk. (2016). About Us – Airbnb. [online] Available at: https://www.airbnb.co.uk/about/about-us [Accessed 15 Nov. 2016].
Airbnb.co.uk. (2017). Holiday Rentals, Homes, Experiences & Places – Airbnb. [online] Available at: https://www.airbnb.co.uk/host?from_nav=1 [Accessed 18 Apr. 2017].
Aznar, J., Sayeras, J., Rocafort, A. and Galiana, J. (2017). The irruption of AirBNB and its effects on hotels’ profitability: An analysis of Barcelona’s hotel sector. Intangible Capital, [online] 13(1), p.147. Available at: https://upcommons.upc.edu/bitstream/handle/2117/99784/921-4107-1-PB.pdf [Accessed 7 Apr. 2017].
Barnes (2017). Worldwide Industry Market report. [online] USA: C. Barnes & Co. Available at: https://drive.google.com/drive/folders/0B-j82vJb1oS-WmVIVXV3LXdLbWM [Accessed 8 Apr. 2017].
BENCKENDORFF, P., MOSCARDO, G., & PENDERGAST, D. (2010). Tourism and generation Y. Wallingford, Oxfordshire, UK, CAB International. http://dx.doi.org/10.1079/9781845936013.0000.
CBRE Hotels (2016). The Sharing Economy Checks In: An Analysis of Airbnb in the United States. [online] USA, pp.1-15. Available at: http://rss.hsyndicate.com/file/152006083.pdf [Accessed 10 Apr. 2017].
CHENG, M. (2016). Sharing economy: A review and agenda for future research. International Journal of Hospitality Management. 57, 60-70.
Chesky, B. (2014). Belong Anywhere. [online] Blog.airbnb.com. Available at: http://blog.airbnb.com/belong-anywhere/ [Accessed 3 Apr. 2017].
ERT, E., FLEISCHER, A., & MAGEN, N. (2016). Trust and reputation in the sharing economy: The role of personal photos in Airbnb. Tourism Management. 55, 62-73.
Euromonitor (2015). Casting an Eye on 2016: Expectations for the Lodging Industry in the Coming Year. [online] London. Available at: http://0-www.portal.euromonitor.com.emu.londonmet.ac.uk/portal/analysis/tab [Accessed 10 Apr. 2017].
Euromonitor international (2016). AirbnbInc in Travel (World). [online] Euromonitor, pp.1-32. Available at: http://0-www.portal.euromonitor.com.emu.londonmet.ac.uk/portal/analysis/tab [Accessed 7 Apr. 2017].
Euromonitor international (2016). The Sharing Economy in Lodging. [online] Euromonitor international, pp.1-41. Available at: http://0-www.portal.euromonitor.com.emu.londonmet.ac.uk/portal/analysis/tab [Accessed 15 Apr. 2017].
Guttentag, D. and Smith, S. (2017). Assessing Airbnb as a disruptive innovation relative to hotels: Substitution and comparative performance expectations. International Journal of Hospitality Management, [online] 64, pp.1-10. Available at: http://www.sciencedirect.com.lmu.idm.oclc.org/science/article/pii/S0278431916302250 [Accessed 12 Mar. 2017].
Inside Airbnb. (2017). Inside Airbnb. Adding data to the debate.. [online] Available at: http://insideairbnb.com/ [Accessed 22 Apr. 2017].
INTERIAN, J. (2016). Up in the Air: Harmonizing the Sharing Economy Through Airbnb Regulations. Boston College International and Comparative Law Review. Boston College Law School. http://lawdigitalcommons.bc.edu/iclr/vol39/iss1/6.
ITB Berlin (2016). ITB World travel trends report 2016/2017. [online] Berlin: IPK International, pp.1-31. Available at: http://www.itb-berlin.de/media/itb/itb_dl_all/itb_presse_all/World_Travel_Trends_Report_2016_2017.pdf [Accessed 12 Mar. 2017].
KIM S., LEE K.Y., KOO C., & YANG S. (2017). Examining the influencing factors of intention to share accommodations in online hospitality exchange networks. Journal of Travel and Tourism Marketing. 1-16.
Lasserre, P. (2012). Global strategic management. 3rd ed. Basingstoke, Hampshire: Palgrave Macmillan.
Lee, S. and Kim, D. (2017). Brand personality of Airbnb: application of user involvement and gender differences. Journal of Travel & Tourism Marketing, pp.1-14.
LESSIG, L. (2008). Remix: making art and commerce thrive in the hybrid economy. New York, Penguin Press.
Liang, L., Choi, H. and Joppe, M. (2017). Understanding repurchase intention of Airbnb consumers: perceived authenticity, electronic word-of-mouth, and price sensitivity. Journal of Travel & Tourism Marketing, pp.1-17.
Mintel, (2017). Holiday Review – UK – January 2017. [online] Available at: http://0-academic.mintel.com.emu.londonmet.ac.uk/display/792277/# [Accessed 8 Apr. 2017].
Morgan Stanley (2015). Internet, Lodging, Leisure and Hotels. [online] pp.1-54. Available at: http://linkback.morganstanley.com/web/sendlink/webapp/f/9lf3j168-3pcc-g01h-b8bf-005056013100?store=0&d=UwBSZXNlYXJjaF9NUwBiNjVjYzAyNi04NGQ2LTExZTUtYjFlMi03YzhmYTAzZWU4ZjQ%3D&user=bdvpwh9kcvqs-49&__gda__=1573813969_cf5a3761794d8651f8618fc7a544cb82 [Accessed 19 Apr. 2017].
O’Sullivan, F. (2016). The European Crackdown on Airbnb. [online] CityLab. Available at: http://www.citylab.com/housing/2016/06/european-cities-crackdown-airbnb/487169/ [Accessed 18 Apr. 2017].
Reuters. (2017). Airbnb has no plans for IPO yet – CEO Chesky. [online] Available at: http://www.reuters.com/article/airbnb-ceo-idUSL2N1GQ1M4 [Accessed 15 Mar. 2017].
Share The World’s Resources, (2012). Financing the global sharing economy: how to mobilise $2.8 trillion to prevent life-threatening deprivation, reverse austerity measures, and mitigate the human impacts of climate change.. [online] london: Share The World’s Resources, pp.14-20. Available at: http://www.sharing.org/sites/default/files/images/PDFs/Report_FinancingGlobalSharingEconomy.pdf [Accessed 3 Apr. 2017].
Slee, T. (2017). Airbnb Data Collection: Get the Data. [online] Tom Slee. Available at: http://tomslee.net/airbnb-data-collection-get-the-data [Accessed 24 Mar. 2017].
Southan, J (2016), ‘Here to stay’, Business Traveller (UK/Europe Edition), pp. 22-28, Business Source Complete, EBSCOhost, viewed 11 November 2016.
Statista (2016). Dossier Airbnb. [online] Statista, pp.1-51. Available at: https://0-www.statista.com.emu.londonmet.ac.uk/study/24578/airbnb-statista-dossier/ [Accessed 9 Apr. 2017].
Statista. (2016). Statistics and facts on Airbnb. Available: https://www.statista.com/topics/2273/airbnb/. Last accessed 11th Nov 2016.
STR, (2017). Airbnb & Hotel performance. [online] Hendersonville: STR, Inc. Available at: http://www.str.com/Media/Default/Research/STR_AirbnbHotelPerformance.pdf [Accessed 1 Apr. 2017].
Ting, D. (2017). Airbnb Is Becoming an Even Bigger Threat to Hotels Says a New Report. [online] Skift. Available at: https://skift.com/2017/01/04/airbnb-is-becoming-an-even-bigger-threat-to-hotels-says-a-new-report/ [Accessed 16 Apr. 2017].
Turulja, L. and Bajgoric, N. (2016). Innovation and Information Technology Capability as Antecedents of Firms’ Success. Interdisciplinary Description of Complex Systems, 14(2), pp.148-156.
Varma, A., Jukic, N., Pestek, A., Shultz, C. and Nestorov, S. (2016). Airbnb: Exciting innovation or passing fad?. Tourism
from KDE Direct Web Site: https://cdn.shopify.com/s/files/1/0496/8205/files/KDE_Direct_XF_CF_Brushless_Performance_Testing_-_KDE10218XF-105.pdf?7734511287488513374
Kelvin Hughes. (2014). UAV and drone detection radar. Retrieved from Kelvin Hughes Web Site: https://cdn.kelvinhughes.com/upload/pdf/brochures/security-lightweight.pdf
Kiribayashi, S., Ashizawa, J., & Nagatani, K. (2015). Modeling and design of tether powered multicopter. International Symposium on Safety, Security, and Rescue Robotics. West Lafayette, IN: IEEE. doi:10.1109/SSRR.2015.7443016
Kiribayashi, S., Ashizawa, J., & Nagatani, K. (2015). Modeling and design of tether powered multicopter. International Symposium on Safety, Security, and Rescue Robotics. West Lafayette, IN: IEEE. doi:10.1109/SSRR.2015.7443016
Kiribayashi, S., Yakushigawa, K., & Nagatani, K. (2017). Design and development of tether-powered multirotor micro unmanned aerial vehicle system for remote-controlled construction machine. 11th Conference on Field and Service Robotics. Zurich. Retrieved from http://www.fsr.ethz.ch/papers/FSR_2017_paper_24.pdf
Lee, T. (2015, September 8). Geometric control for a tethered UAV. Retrieved from arXiv Cornell University: https://arxiv.org/pdf/1509.02570.pdf
Lillian, B. (2017, September 20). Virginia Tech: how much injury can a drone crash cause? it depends. Retrieved from Unmanned Aerial Web Site: https://unmanned-aerial.com/virginia-tech-much-injury-can-drone-crash-cause-depends
Maryland Department of Commerce. (2015). UAS and Maryland: opportunity and accountability. Department of Commerce. Maryland Department of Commerce. Retrieved February 25, 2018, from http://commerce.maryland.gov/Documents/ProgramReport/Maryland-UAS-report.pdf
Morales-Perryman, Q., & Lee, D. D. (2013). Tethering system for unmanned aerial vehicles. https://www.seas.upenn.edu/sunfest/docs/papers/13-Morales-report.pdf.
Muttin, F. (2011). Umbilical deployment modeling for tethered UAV detecting oil pollution from. Applied Ocean Research, 332-343. doi:10.1016/j.apor.2011.06.004
NASA . (2017). USS specification. Retrieved from National Aeronautics and Space Administration : https://ntrs.nasa.gov/archive/nasa/casi.ntrs.nasa.gov/20170011588.pdf
Nicotra, M., Naldi, R., & Garone, E. (2017). Nonlinear control of a tethered UAV: the taut cable case. Automatica, 174-184.
Pieraccini, M., & Miccinesi, L. (2017). CWSF radar for detecting small UAV’s. International Conference on Microwaves, Antennas, Communications and Electronic Systems. Firenze, Italy: IEEE.
Russell, A., & Mezin, A. (2016, April 21). DCM for tethered UAV applications. Retrieved from Vicor Web Site: http://powerblog.vicorpower.com/2016/04/dcms-keep-tethered-drones-flying/
Sandino, L. A., Bejar, M., Kondak, K., & Ollero, A. (2104). Advances in modeling and control of tethered unmanned helicopters to enhance hovering performance. Journal of Intelligent & Robotic Systems, 73(1-4), 3-18. doi:10.1007/s10846-013-9910-y
Selvaganapathy, S., & Ilangumaran, A. (2017, April). Design of quadcopter for aerial view and organ transportation using drone technology. Asian Journal of Applied Science and Technology, 1(3), 311-315. Retrieved from http://ajast.net/data/uploads/3ajast-79.pdf
Skupniewicz Smith, I. (2018, March). NASA utm-apis. Retrieved from GitHub Web Site: https://github.com/nasa/utm-apis/blob/master/uss-api/swagger.yaml
Smith, I. S., Rios, J. L., McGuirk, P. O., Mulfinger, D. G., Venkatesan, P., Smith, D. R., . . . Wang, L. (2017, April). UTM TCL 2 software requirements. Retrieved from National Aeronautics and Space Administration : https://utm.arc.nasa.gov/docs/Smith-UTM-CTL2-Requirements-NASA-TM-219513.pdf
U.S. Department of Transportation. (2017, October 25). President Donald Trump and Secretary Elaine L. Chao announce innovative drone integration pilot program. Retrieved February 25, 2018, from U.S. Department of Transportation: https://www.transportation.gov/UAS-integration-pilot-program
UAS Vision. (2017, December 18). Safety board report on drone/black hawk collision. Retrieved from UAS Vision Web Site: https://www.uasvision.com/2017/12/18/safety-board-report-on-droneblack-hawk-collision/
Wolff, C. (2009, December 20). Radar basics. Retrieved from Radar Tutorial EU Web Site: http://www.radartutorial.eu/druck/Book1.pdf
Zikou, L., Papachristos, C., & Tzes, A. (2015). The power–over–tether system for powering small UAVs: tethering–line tension control synthesis. 23th Mediterranean Confrence on Control and Automation. Torremolinos: IEEE. doi:10.1109/MED.2015.7158825
Click
Appendix A
USSREQ-API UTM Source Code (Skupniewicz Smith, 2018)
summary: Request information regarding Operations
parameters:
– name: registration_id
in: query
type: array
minItems: 1
maxItems: 5
uniqueItems: true
items:
type: string
format: uuid
minLength: 36
maxLength: 36
collectionFormat: csv
type: array
minItems: 1
maxItems: 5
uniqueItems: true
items:
type: string
enum:
– ACCEPTED
– ACTIVATED
– CLOSED
– NONCONFORMING
– ROGUE
– INTRUDER
minLength: 6
maxLength: 13
– name: distance
in: query
description: >-Distance from reference_point to find operations. Ignored if reference_point is not provided. Units are feet. Returns all operations that have any operation_volumes that interesect the 2D circle defined by distance and reference_point. Default value onlyhas meaning when reference_point parameter is provided.
type: integer
format: int32
maximum: 60762
minimum: 1
default: 300
required: false
– name: reference_point
in: query
description: >-
A single point used to find all operations within some distance from that point. Returns all operations that have any operation_volumes that interesect the 2D circle defined by distance and reference_point. When distance it excluded and reference_point is included, use default value (300ft) for distance. Described as a GeoJSON position. The value is
young children as well as people of small stature who are exposed to too much danger. As air bags have safety benefits, the technological definition focal points on the negative costs of air bags, that are a more serious problem than depicted by either the behavioural or authoritarian definitions. (Coughlin 1994)
To reveal the amount of this problem, the amount of fatalities is a key statistic that is referenced. Moreover, the number of air bags in employ, both driver as well as passenger side, are recognized to exemplify the prevalence of air bags in today’s automobile fleet. As Jim Hall (National Transportation Safety Board (NTSB)) gives evidence, “[w]e add another 1 million vehicles each month with air bag technology that is not protected for everybody, as well as specially not for children”. This marker assists to demonstrate that the problem is one that potentially faces a large segment of the population. (Dahl 1982)
Nothing like the other definitions, it is the technology that is the major cause of the deaths. The technology is described as crude; comparable to a one-size-fits-all piece of clothing. What creates one individual secure, though, will not essentially offer the same amount of safety to the next occupant. As a substitute of sensing the size of an individual, whether or not the person is belted, or whether a child safety seat is there, today’s generation of air bags deploy with one consistent force. This is why persons of small stature as well as young children are placed at danger during air bag deployment. Insufficient research as well as development has been mannered to create the next generation of air bags that will decrease the danger to smaller occupants. (Damsgaard 2001)
Obviously, the solution is to develop air bags that deploy with forces that are customized to the occupant as well as the conditions of the crash. Advanced technology holds the answer to improving air bag safety. These [“]smart” air bags will offer greater safety remunerations than existing ones without the amplified exposure to danger that young children as well as occupants of small stature currently face. As these technological growths are not directly available, short-term solutions comprise of depowering, installing on-off switches, as well as deactivation on demand. The last two of these short-term solutions offer the resident with the alternative of using the active technology. (Decker 1984)
A number of proponents imply that government regulation desires to be ratifies to motivate producers to expand smart bags. In reference to setting government standards pertaining to neat technologies in the future, Mr. Hall stated:
“I think the economic thoughts are the actuality here, Senator, as well as the automobile manufacturers, until the Federal government sets the standard, are not going to initiate the changes that are required.” (Epidemiology 2002 p71)
Charles H. Pully (Automotive Restraints Council) went further as well as testified: (Glass 2000 p89)
“So when will the sophisticated smart restraint organism [be] available? If we have aggressive targets set, the 2000 model year is not unreasonable. That’s the 1999 calendar year.” (Grisoni 2000 p164)
These solutions unreservedly worth technology, as future advances will make the motor vehicle an still safer means of transportation. (Ai & Norton 2003)Additionally, passive protection is valued, as the final goal is to create an air bag that suggests safety reimbursements to all occupants without any responsibility positioned on the occupant to make sure proper usage. (Braver, Whitfield & Ferguson 1997)Outmoded as well as hazardous technology is employed as an efficient symbol to heighten awareness for creating new technology. The present generation is referred to as “dumb` air bags, whilst the new as well as improved generation is “smart` technology. (Calvert & McCubbins 1989)
Corporate Greed Definition
Under the corporate greed definition we are faced with an emergency or crisis. It is not that occupants are inadvertently dying, it is that air bags are killing people. In particular, air bags are killing young children. Even though it is acknowledged that some small women as well as senior citizens have died as a result of air bag deployments, it is the death of the child that is the focus of this description. (Epidemiology 2002)
As confirmation to validate this depiction, the number of children whose deaths have been credited to air bag deployments is obtainable. Their ages are identified as well as the circumstances surrounding their death. Frequently presented is a description of the way in that the air bag caused the death.
These are children who were “struck in the face by air bags, all in low speed collisions in that normally they would have survived”. (Corneli 2000)Approximation of future child losses due to air bag deployments is also offered. (Damsgaard 2001)
Air bags are killing twice as a lot of children as they are saving, as well as the most current projection that I have seen
A softcopy of the Project final report
A turnitin copy of the document
Program code on the CD
Software and development requirement used document
Development requirement of the system are:
MySQL Server
Windows Vista
Nokia series
Designing a Application from user point of view.
As stock quote is never easy before computer start to serve the user demand ,as a stock market person has to know the rate of the stock till up to date but these are possible by Internet as simple as single click you would know the value from past record to till now . In the period when the computer are not as personal computer those days the person itself has to find the stock value through Walk-in to the local newsagent to buy NEWS paper or Television or even Radio but this media were not that reliable as today’s technology which Internet, computer ,wireless. But technology start to change the way of stock market working from the traditional method . However our aim is to provide a reliable method for a person to access the stock market condition as easy as possible by using it. So we have to design a application which will server the user need in simple way .,to fulfil there need as application designer has to thing generously from user point of view. Some of the questions are striked
- Is this application or service are able to served the user needs or it just focus on business prospective .
- Is the user getting any useful and benefit from the application or web page is been designed .
- How reliable is this application whether is based on other source or direct information from the stock company
- User interface is most important part for a application ,it must has to be easy to user to use .
To design the WAP application we have to gather relevant information or opion from stock holders who really would get benefit from this WAP application as a user. I managed to contact two persons who using the computer to keep to know stock market rate. Their ultimate demand is that interface must has to simple and provide the useful information as simple as possible like simple graph, etc. So the application is designed to help the user so interface has to simple but not to find how to use it, this will leads poor impression on the application. However everyone has different thoughts from thinging of what they want to make them comfortable well i concluded the thoughts of stock market users what do they want the application has to appear and help them to easy way of tracking the current value of the stock market.
Ease of use:
As a normal user cannot read manual, particularly for some simple service like sending a message, so if they cannot know how to use the application ,they get frustrated and tent to leave the application altogether. That means if the application is not fully intuition, then people will get stuck and we might lose them forever. The user will not come to figure out how to get the application to work .Another ease of use factor is the difficulty of getting to a URL.
When designing a software for certain purpose where the user could get useful by that . The software itself has to serve the purpose that made up for what .There is major role for design a application how it will become useable by user. However ,if the user’s goal and the applications are not same ,there may be a problem . for example user want to know the previous stock market rate and average of the rate by performs of the particular company stock from past fifteen days data report , in order to plan for feature plan and to analysis on the market .And if my application only provide the stock value for the past seven days ,in this case the application is not provide the solution to the user demand.
To provide the full potential of the application to user by developing or designing the option in the application as simple as possible o obtain the what is wanted to use by the user. For instance If user if user is holding stock in five major companies shares ,for him or his need to see the top companies which he or she interested should show at first place instant of thousands of company from the list . So in here we deploying the user reliable context to reduce complex problem into simple solution. We can able to attract the user or customer to use our application or provide.
The application must have to provides critical inf
Investment in AIM trading companies leads to indemnity from inheritance tax.
Enterprise investment scheme offers relief from both income tax and capital gains tax. From the initial investment in new AIM shares about one fifth of the cost can be counterbalanced against income tax. In addition any capital gain is exempt from capital gains tax, while any capital loss (less the 20% income tax relief) can be offset against capital gains elsewhere.
Investors are exempt from tax on dividends from the Venture Capital Trusts, and capital gains on their shares in the VCT. Investors also receive an initial income tax relief equal to 40% of their investment in new VCT shares.
2.2.6 REQUIREMENTS AND LISTING PROCEDURE
Companies listed on AIM have to assign a nominated adviser to serve as their sponsor or representative and is responsible to prepare the prospectus in order to admit the issuer for trading on AIM. The function of a nomad is to assists the company in raising its initial capital provide market making and research for the issuer’s stock with the help of its brokerage and research departments. The contractual activities and correlation between the issuer and its nomad extends well beyond the initial public offering. Nomad remain active even after the initial listing on AIM so that a small issuer does not end up being left alone in a stock market crisis. New rules and regulations were instituted both for nomads and companies listed on the AIM exchange, in Feb, 2007. To provide further guidance and to illuminate the regulatory issues concerning disclosure requirements the rules for nomads and companies were put into practice. Although the changes to AIM rules are evolutionary rather than revolutionary, Nomads should not under-estimate the Exchange’s emphasis on the responsibility of nomads for preserving the reputation and integrity of AIM (Audley, 2005).
2.3 ASSOCIATED RISKS AND BENEFITS
The listing procedure is much more simplified in London Stock Exchange as there is no regulatory authority in the UK so it becomes the responsibility of the sponsoring nomad as a result of which the complete process becomes substantially quicker and inexpensive. The prospectus discloses all information that an investor needs for making an informed investment decision and it’s less comprehensive in most cases where the SEC-filed registration statement and the review process, for the most part, is absent (Audley, 2005). Therefore, the SEC governmental review process of the prospectus, the massive amount of periodic regulatory filings and compulsory financial reporting needs are eradicated by listing on AIM. The emerging growth companies are offered with very greater options by eliminating the need for underwriters that are only interested large deals so a great number of foreign companies are flocking to AIM (London Stock Exchange, 2006). Listing on AIM gives an emerging growth company the opportunity to go public and raise capital for reasonable fees and under reasonable terms and conditions.
AIM rules require not only a nominated broker but also a nominated adviser. There were companies on AIM which caused regulatory nervousness and the big guns at the DTI, Treasury and Stock Exchange focused their canon on nominated advisers. This had a knock-on effect on costs. Nominated advisers lay off their responsibilities on solicitors and accountants who duly reproduce and costs shoot up (London Stock Exchange, 2006). Professional advisers, anxious to minimise the risk of adverse criticism by the regulatory authorities, are now applying Official List standards. This has driven costs up and has damaged the purpose of AIM (London Stock Exchange, 2006).
2.4 FISCAL AGITATION AND AIM
Economic recovery is gradual but consistent followed by the recession that hit the stock markets worldwide and for London Stock Exchange, particularly AIM market; there is a need for investment by small companies. The number of companies quoted on AIM, which is the London Stock Exchange’s Alternative Investment Market, is now just 1,276 compared with more than 1,600 in the year 2007, which constitutes that, more than one company a day delists from AIM throughout last year (Northedge, 2010). It is also noticeable that notwithstanding the soaring share prices up to 66 per cent in the year 2009, outperforming the main stock market, only 36 new companies joined AIM. It is the lowest annual total since the launch of AIM in1995 and a tiny fraction as compared to the joining of 462 companies that in 2006 (Northedge, 2010). About 290 companies delisted compared with 218 in the year 2008, and others have been liquidating their assets and returning the proceeds to shareholders. Reported by (Wachman, 2009) in Guardian, ‘The number of companies having a capital under £5m or £10m has halved within two years and approximately two-thirds of AIM’s companies are capitalised at less than £25m and almost10 per cent are valued at below £2m’. Despite share prices falling, the delisting of the small firms has become a basis for the average AIM Company’s estimation twofold to £43m since the year 2006. The continued loss of small firms from AIM and some Britain’s top 200 companies remain there give rise to a fear that AIM will become another version of the main market leaving no alternative for smaller businesses to be quoted. That is already making it harder for small firms to raise capital to
multi chip module (MCM) design and “Flexpoint” architecture with twelve specialized multicore processing nodes somewhat like the Google TPU’s matrix multiply unit and has 32 GB of High Bandwidth Memory 2 (HBM2) with an aggregate 8 TB
bandwidth [25]. The Knupath Hermosa has 256 DSP cores organized in eight cluster of eight cores connected by it’s Lambda Fabric which is also designed to create a low latency high throughput mesh to link thousands of Hermosa processors [25] and is shown in figure . The Hermosa includes an integrated L1 router with 32 ports for a bandwidth of 1 Tbit/s and links to the network by 16 10 Gbit/s bidirectional ports [25].Although CPUs and GPUs do most of the AI work now there is a lot of promise in the development of new AI chips. The Nvidia Jetson TX2 board can also be used as an AI accelerator in the tiny Intel Curie model [25].
The new AI chips used as examples show we are moving forward with both onboard and cloud type systems. AI and ML including DNN can help Robotic systems in vision including object recognition and manipulation, kinematics for movement planning and optimization, and many other tasks. Architecture of robotic systems which require AI processing needs to not only provide design for implementation of hardware for onboard and offboard processing, but also be able to decide when to process locally and when to outsource to the cloud by what is most efficient in combination of speed and power savings specific to their task(s) and platforms.
REFERENCES :-
[1] A. N. Meltzoff, Elements of a Developmental Theory of Imitation. Cambridge, MA, USA: Cambridge University Press, 2002, pp. 19–41.
[2] R. Rao, A. Shon, and A. Meltzoff, “A Bayesian Model of Imitation in Infants and Robots,” in Imitation and Social Learning in Robots, Humans, and Animals, 2004, pp. 217–247.
[3] D. B. Grimes and R. P. N. Rao, “Learning Actions through Imitation and Exploration: Towards Humanoid Robots that Learn from Humans,” in Creating Brain-Like Intelligence, ser. Lecture Notes in Computer Science, vol. 5436. Springer, 2009, pp. 103–138.
[4] L. Montesano, M. Lopes, A. Bernardino, and J. Santos-Victor, “Learning Object Affordances: From Sensory–Motor Coordination to Imitation,” IEEE Transactions on Robotics, vol. 24, no. 1, pp. 15–26, 2008.
[5] C. Acosta-Calderon and H. Hu, “Robot Imitation: Body Schema and Body Percept,” Applied Bionics and Biomechanics, vol. 2, no. 3-4, pp. 131–148, 2005.
[6] D. Jain, L. M¨osenlechner, and M. Beetz, “Equipping Robot Control Programs with First-order Probabilistic Reasoning Capabilities,” in IEEE Int. Conf. on Robotics and Automation, 2009, pp. 3130–3135.
[7] M. Toussaint, N. Plath, T. Lang, and N. Jetchev, “Integrated Motor Control, Planning, Grasping and High-level Reasoning in a Blocks World using Probabilistic Inference,” in IEEE International Conference on Robotics and Automation, 2010, to appear.
[8] C. L. Nehaniv and K. Dautenhahn, Eds., Imitation and Social Learning in Robots, Humans, and Animals: Behavioural, Social and Communicative Dimensions. Cambridge University Press, 2004.
[9] D. Wolpert and M. Kawato, “Multiple Paired Forward and Inverse Models for Motor Control,” Neural Networks, vol. 11, no. 7-8, pp. 1317–1329, October 1998.
[10] Y. Demiris and M. Johnson, “Distributed, Predictive Perception of Actions: A Biologically Inspired Robotics Architecture for Imitation and Learning,” Connection Science, vol. 15, no. 4, pp. 231–243, 2003. [11] E. Oztop, D. Wolpert, and M. Kawato, “Mental State Inference using Visual Control Parameters,” Cognitive Brain Research, vol. 22, no. 2, pp. 129–151, February 2005.
[12] K. Huebner, S. Ruthotto, and D. Kragic, “Minimum Volume Bounding Box Decomposition for Shape Approximation in Robot Grasping,” in IEEE Int. Conf. on Robotics and Automation, 2008, pp. 1628–1633. [13] A. Miller and P. Allen, “Graspit! A Versatile Simulator for Robotic Grasping,” Robotics and Automation, vol. 11 (4), pp. 110–122, 2004.
[14] Z. Xue, A. Kasper, M. J. Zoellner, and R. Dillmann, “An Automatic Grasp Planning System for Service Robots,” in 14th International Conference on Advanced Robotics, 2009.
[15] J. Pearl, Probabilistic Reasoning in Intelligent Systems: Networks of Plausible Inference. Morgan Kaufmann, September 1988.
[16] A. Rao, B. A. Olshausen, and M. Lewicki, Eds., Probabilistic Models of the Brain: Perception and Neural Function. MA: MIT Press, 2002.
[17] R. Z¨ollner, M. Pardowitz, S. Knoop, and R. Dillmann, “Towards Cognitive Robots: Building Hierarchical Task Representations of Manipulations from Human Demonstration,” in IEEE International Conference on Robotics and Automation, 2005, pp. 1535–1540.
[18] M. Novotni and R. Klein, “Shape Retrieval using 3D Zernike Descriptors,” Computer-Aided Design, vol. 36 (11), pp. 1047–1062, 2004.
[19] P. Shilane, P. Min, M. Kazhdan, and T. Funkhouser, “The Princeton Shape Benchmark,” in International Conference on Shape Modeling and Applications, 2004, pp. 167–178.
[20] M. Ciocarlie, C. Goldfeder, and P. Allen, “Dexterous Grasping via Eigengrasps: A Low-dimensional Approach to a High-complexity Problem,” in RSS 2007 Manipulation Workshop, 2007.
[21] C. Ferrari and J. Canny, “Planning Optimal Grasps,” in IEEE Int. Conference on Robotics and Automation, vol. 3, 1992, pp. 2290–2295.
[22] K. Murphy, “BNT – Bayes Net Toolbox for Matlab,” [URL] http: //code.google.com/p/bnt/, 1997. Last visited July 15, 2010.
[23] (2018). Intelligent Robots: A Feast for the Senses. Available: https://www.robotics.org/content-detail.cfm/Industrial-Robotics-Industry-Insights/Intelligent-Robots-A-Feast-for-the-Senses/content_id/5530
[24] “Global Robotics System Integration Market 2017 – Dynamic Automation, Geku Automation, RobotWorx, Midwest Engineered Systems, Van Hoecke Automation – Albanian Times,” 2017-06-08 2017.
[25] W. Wong. (2017) CPUs, GPUs, and now: AI chips. 22. Available: http://search.ebscohost.com/login.aspx?direct=true&db=edsgea&AN=edsgcl.497612004&site=eds-live
[26] “A cloud computing approach to complex robot vision tasks using smart camera systems,” ed, 2010, p. 3195.
[27] E. Ackerman, “Motion-Planning Chip Speeds Robots,” IEEE Spectrum, 2018.
[28] “FPGA-based bio-inspired architecture for multi-scale attentional vision,” ed: ECSI, 2016, p. 231.
[29] M. Peker, H. Altun, and F. Karakaya, “Hardware implementation of a scale and rotation invariant object detection algorithm on FPGA for real-time applications,” Turkish Journal of Electrical Engineering & Computer Sciences, Article vol. 24, no. 5, pp. 4368-4382, 08// 2016.
[30] E. Ackerman, “Dynamic Vision Sensors Enable High-Speed Maneuvers With Robots,”Available: https://spectrum.ieee.org/automaton/robotics/robotics-hardware/dynamic-vision-sensors-enable-high-speed-maneuvers-with-robots
[31] H. Bistry and J. Zhang, “A cloud computing approach to complex robot vision tasks using smart camera systems,” ed, 2010, p. 3195.
[32] “Nvidia’s Pascal-powered Jetson TX2 computer blows away Raspberry Pi,” ed, 2018.
[33] “The microarchitecture of a real-time robot motion planning accelerator,” ed: IEEE, 2016, p. 1.
The results of this study suggest that the activity of various promoters and oprons (PII, PIII and egc operon) in S. aureus is directly related to Lucas agr. This suggests a role for SAgs as checkpoints of dissemination. Evidence suggests that when SAgs are systemic as in the case of meny toxins, S. aureus is able to prevent dissemination, which may be partly why bacteremia is rarely associated with staphylococcal agr locus. Also, the knowledge derived from the results of this study states that the role of locus agr in activating regulatory systems for the survival of the bacterium. This causes the bacteria to increase their antibiotic resistance in an environmentally-friendly environment, along with the maintenance of pathogenicity.
7.Acknowledgments
The authors of this article are grateful to Hamedan University of Medical Sciences for their financial support in conducting research.
References
1. Beceiro A, Tomás M, Bou G. Antimicrobial Resistance and Virulence: a Successful or Deleterious Association in the Bacterial World? Clinical Microbiology Reviews. 2013;26(2):185-230.
2. Bokaeian M, Tahmasebi H. Molecular Identification of Genes Responsible for Resistance to Aminoglycosides and Methicillin in Clinical Samples of Staphylococcus Aureus. Journal of Babol University Of Medical Sciences. 2017;19(3):38-46.
3. Bae T, Glass EM, Schneewind O, Missiakas D. Generating a collection of insertion mutations in the Staphylococcus aureus genome using bursa aurealis. Methods in molecular biology. 2008;416:103-16.
4. Schlievert PM, Case LC, Strandberg KL, Tripp TJ, Lin Y-C, Peterson ML. Vaginal Staphylococcus aureus Superantigen Profile Shift from 1980 and 1981 to 2003, 2004, and 2005. Journal of Clinical Microbiology. 2007;45(8):2704-7.
5. Jarraud S, Mougel C, Thioulouse J, Lina G, Meugnier H, Forey F, et al. Relationships between Staphylococcus aureus Genetic Background, Virulence Factors, agr Groups (Alleles), and Human Disease. Infection and Immunity. 2002;70(2):631-41.
6. Soares BS, Melo DA, Motta CC, Marques VF, Barreto NB, Coelho SMO, et al. Characterization of virulence and antibiotic profile and agr typing of Staphylococcus aureus from milk of subclinical mastitis bovine in State of Rio de Janeiro. Arquivo Brasileiro de Medicina Veterinária e Zootecnia. 2017;69:843-50.
7. Suryadevara M, Clark AE, Wolk DM, Carman A, Rosenbaum PF, Shaw J. Molecular Characterization of Invasive Staphylococcus aureus Infection in Central New York Children: Importance of Two Clonal Groups and Inconsistent Presence of Selected Virulence Determinants. Journal of the Pediatric Infectious Diseases Society. 2013;2(1):30-9.
8. Vitali LA, Petrelli D, Lamikanra A, Prenna M, Akinkunmi EO. Diversity of antibiotic resistance genes and staphylococcal cassette chromosome mec elements in faecal isolates of coagulase-negative staphylococci from Nigeria. BMC microbiology. 2014;14(1):106.
9. Duran N, Ozer B, Duran GG, Onlen Y, Demir C. Antibiotic resistance genes & susceptibility patterns in staphylococci. The Indian journal of medical research. 2012;135(3):389-96.
10. Touboul-Lundgren P, Jensen S, Drai J, Lindbæk M. Identification of cultural determinants of antibiotic use cited in primary care in Europe: a mixed research synthesis study of integrated design “Culture is all around us”. BMC Public Health. 2015;15:908.
11. Norris P, Chamberlain K, Dew K, Gabe J, Hodgetts D, Madden H. Public Beliefs about Antibiotics, Infection and Resistance: A Qualitative Study. Antibiotics. 2013;2(4):465-76.
12. Wushouer H, Zhang Z-X, Wang J-H, Ji P, Zhu Q-F, Aishan R, et al. Trends and relationship between antimicrobial resistance and antibiotic use in Xinjiang Uyghur Autonomous Region, China: Based on a 3 year surveillance data, 2014–2016. Journal of Infection and Public Health. 2017.
13. Thompson TA, Brown PD. Association between the agr locus and the presence of virulence genes and pathogenesis in Staphylococcus aureus using a Caenorhabditis elegans model. International Journal of Infectious Diseases. 2017;54:72-6.
14. Yu F, Liu Y, Lv J, Qi X, Lu C, Ding Y, et al. Antimicrobial susceptibility, virulence determinant carriage and molecular characteristics of Staphylococcus aureus isolates associated with skin and soft tissue infections. The Brazilian Journal of Infectious Diseases. 2015;19(6):614-22.
15. Stach CS, Vu BG, Merriman JA, Herrera A, Cahill MP, Schlievert PM, et al. Novel Tissue Level Effects of the Staphylococcus aureus Enterotoxin Gene Cluster Are Essential for Infective Endocarditis. PloS one. 2016;11(4):e0154762.
16. Deodhar D, Varghese G, Balaji V, John J, Rebekah G, Janardhanan J, et al. Prevalence of Toxin Genes among the Clinical Isolates of Staphylococcus aureus and its Clinical Impact. Journal of global infectious diseases. 2015;7(3):97-102.
17. Elazhari M ED, Zerouali K, Dersi N, Elmalki A, et al. Prevalence and Distribution of Superantigen Toxin Genes in
Fatality Statistics 2015–2016. Metropolitan Buildings, James Joyce Street, Dublin, Ireland: Health and Safety Authority.
Health and Safety Authority, 2017b. Code of Practice for Preventing Injury and Occupational Ill Health in Agriculture. Metropolitan Buildings, James Joyce Street, Dublin, Ireland: Health and Safety Authority.
Health and Safety Authority, 2017c. Annual Report 2016. Metropolitan Building, James Joyce Street, Dublin 1.: Health and Safety Authority.
Health and Safety Authority, 2018a. Quad Bike Safety Update. Metropolitan Buildings, James Joyce Street, Dublin: Health and Safety Authority.
Health and Safety Authority, 2018b. Reducing the Risk of Back Injuries on the Farm. Metropolitan Buildings, James Joyce Street, Dublin 1: Health and Safety Authority.
Health and Safety Authority, 2018. Programme of Work. Metropolitan Building, James Joyce Street, Dublin 1.: Health and Safety Authority.
Health and Safety Executive, 2012. Agriculture Information Sheet No 35 (Revision 1) – Handling and housing cattle. Sudbury: Health and Safety Executive.
Health and Safety Executive, 2017. Farmwise: Your essential guide to health and safety in agriculture. 3rd ed. Norwich, Untied Kingdom: The Stationery Office.
Health and Safety Executive, 2017. Health and Safety in the Agriculture, Forestry and Fishing Sector in Great Britain, 2017, Sudbury, Great Britain: HSE Books.
Heaton, K. et al., 2012. The effects of arthritis, mobility, and farm task on injury among older farmers. Nursing: Research and Reviews, Volume 2, pp. 9-12.
Horsburgh, S., Feyer, A. & Langley, J., 2001. Fatal work related injuries in agricultural production and services to agriculture sectors of New Zealand, 1985–94. Occupational and Environmental Medicine, Volume 58, pp. 489-495.
Kenny, O., Maître, B. & Russell, H., 2018. Analysis of Work-related Injury and Illness, 2001 to 2014 Agriculture, Forestry and Fishing Sector – Sectoral Analysis No. 4: Agriculture, Forestry and Fishing Sector, Whitaker Square, Sir John Rogerson’s Quay, Dublin, Ireland: The Economic and Social Research Institute & The Health and Safety Authority.
Kumar, S., 2001. Theories of musculoskeletal injury causation. Ergonomics, 44(1), pp. 17-47.
Lazarus, R., 1966. Psychological stress and the coping process. New York: McGraw-Hill.
Lazarus, R. & Folkman, S., 1984. Stress, Appraisal and Coping. New York: Springer.
Lindahl, C., Pinzke, S., Herlin, A. & Keeling, L. J., 2016. Human-animal interactions and safety during dairy cattle handling-Comparing moving cows to milking and hoof trimming. Journal of Dairy Science, 99(3), p. 2131–2141.
Madan, I. & Grime, P. R., 2015. The management of musculoskeletal disorders in the workplace. Best Practice & Research Clinical Rheumatology, 29(3), pp. 345-355.
Mahon, M. et al., 2017. An assessment of Irish farmers’ knowledge of the risk of spread of infection from animals to humans and their transmission prevention practices. Epidemiology and Infection, 145(12), p. 2424–2435.
McIntosh, W. et al., 2016. Suicide Rates by Occupational Group — 17 States, 2012. Morbidity and Mortality Weekly Report (MMWR) , 65(25), pp. 641-645.
Morgaine, K., Langley, J., McGee, R. & Gray, A., 2014. Impact evaluation of a farm safety awareness workshop in New Zealand. Scandinavian Journal of Work, Environment & Health, 40(6), pp. 649-653.
National Institute for Occupational Safety and Health, 1997. Musculoskeletal Disorders and Workplace Factors. A Critical Review of Epidemiologic Evidence for Work-related Musculoskeletal Disorders of the Neck, Upper Extremity, and Low Back. DHHS(NIOSH) Publication No. 97–141 ed. Cincinnati: National Institute for Occupational Safety and Health.
Osborne, A. et al., 2012. Prevalence of musculoskeletal disorders among farmers: A systematic review. American Journal of Industrial Medicine, 55(2), pp. 143-158.
Osborne, A. et al., 2010. Musculoskeletal disorders among Irish farmers. Occupational Medicine, 60(8), p. 598–603.
Osborne, A. et al., 2013. An evaluation of low back pain among farmers in Ireland. Occupational Medicine (London), 63(1), pp. 53-59.
O’Sullivan, D., Cunningham, C. & Blake, C., 2009. Low back pain among Irish farmers. Occupational Medecine , 59(1), p. 59–61.
Pacific Northwest Agricultural Safety and Health Center, 2004. National Tractor Safety Initiative. Seattle: National Institute for Occupational Safety and Health.
Parry, J., Barnes, H., Lindsey, R. & Taylor, R., 2005. Farmers, Farm Workers and Work-Related Stress, Sudbury, Great Britain: Health and Safety Executive.
Pickett, W., Berg, R. & Marlenga, B., 2017. Social environments, risk-taking and injury in farm adolescents. Injury Prevention, 23(6), pp. 388-398.
Rorat, M., Thannhauser, A. & Jurek, T., 2015. Analysis of injuries and causes of death in fatal farm-related incidents in Lower Silesia, Poland. Annals of Agricultural and Environmental Medicine, 22(2), pp. 271-274.
Rosecrance, J., Rodgers, G. & Merlino, L., 2006. Low back pain and musculoskeletal symptoms among Kansas farmers. American Journal of Industrial Medicine, Volume 49, pp. 547-556.
Russell, H., Maître, B. & Watson, D., 2015. Trends and Patterns in Occupational Health and Safety in Ireland. Whitaker Square, Sir John Rogerson’s Quay, Dublin, Ireland: The Economic and Social Research Institute.
Russell, H., Maître, B. & Watson, D., 2016. Work-related Musculoskeletal Disorders and Stress, Anxiety and Depression in Ireland: Evidence from the QNHS 2002–2013. Whitaker Square, Sir John Rogerson’s Quay, Dublin, Ireland: The Economic and Social Research Institute.
Shulruf, B. & Balemi, A., 2010. Risk and preventive factors for fatalities in All-terrain Vehicle Accidents in New Zealand. Accident Analysis & Prevention, 42(2), pp. 612-618.
Sorensen, J. et al., 2017. A Comparison of Interventional Approaches for Increasing Power Take-off Shielding on New York Farms. Journal of Agromedicine, 22(3), pp. 251-258.
Springfeldt, B., 1996. Rollover of tractors — international experiences. Safety Science, 24(2), pp. 95-110.
Tiesman, H. M. et al., 2015. Suicide in U.S. Workplaces, 2003–2010. American Journal of Preventive Medicine, 48(6), pp. 674 – 682.
Transport and Road Safety (TARS), 2017. Quad Bike and OPD workplace Safety Survey Report : Results and Conclusions, 92-100 Donnison Street, Gosford, New South Wales 2250: SafeWork NSW.
Watson, D., Kenny, O., Maître, B. & Russell, H., 2017. Risk taking and accidents on Irish farms, Whitaker Square, Sir
Block diagram
Raspberry pi in this project receiving the data from Arduino mega 2560 through serial port and then it process the data and upload it onto internet server and after that it turned off by itself. The whole process has been shown in block diagram. In the start of python script all the ports and pins needs to be initiated. Moreover, all the libraries should be imported in start. The Raspberry pi will store the data available at serial port from Arduino and store it in array using For loop.
The data received through serial port contains a lot of information bits along temperature and humidity bits, so the temperature and humidity bits separated from the array. Temperature and humidity comprises of more than one bit, so their bits combined after separating from array. Temperature and humidity have been calculated from formulas. Then raspberry will look for Internet connection, if internet is not working raspberry pi will give signal to turn it off and if it’s working raspberry pi will complete URL by combining the temperature and humidity value and uploaded onto the internet. After uploading the data to internet, raspberry pi will look for the response from internet server for successful attempt if it doesn’t get confirmation it will keep on trying to upload the data on to internet until it’s done. Raspberry bi starts shutting off and besides that it will communicate with Arduino to turn the power off after raspberry pi turned off. The coding has been included in Appendix.

Aforementioned website has been used as server to upload data. It allows user to make profile and provide the private key and specific URL to upload the data onto the servers. Click the Create option to register for new account as shown in Figure 5.5.Figure 5.5 Data sparkfun
After registration, data can be uploaded to sparkfun servers. The method to upload data is very simple. In this project temperature and humidity are the parameters that has been uploaded to this server so the URL assigned to this project is mentioned below.
Open the URL with humidity and temperature values in the spots mentioned in bold letters accordingly and data will be uploaded to servers. After it uploads the data, it will display 1 SUCCESS as shown

This “1 success” has been used in raspberry pi coding to confirm that data has been uploaded on the server.
5.2.1 Android app
Popularity of cell phones App has been increased dramatically in last decade. They are very easy to use and more easily accessible. An app has been developed for this project to access the data on cellphones. Procedure has been elaborated below
Open the URLwww.appyet.com
Register to make an account on the website and then login as shown in Figure 5.6.

Figure 5.6 Android app
Select the App name as in Figure 5.7.

Figure 5.7 App making
Now select the Modules tab as in Figure 5.8.

Figure 5.8
Click on details right across the Website icon as in Figure 5.9.

Figure 5.9
Now paste the URL and press save changes
Now remove all the Modules one by one by clicking on the details for example select Feed query as in Figure 5.10.

Figure 5.10
Now scroll to the bottom and uncheck the Enable and press save changes as in Figure 5.11.

Figure 5.11
Now disable all the modules except web module.

Figure 5.12

Figure 5.13
Now go to Build tab and click on Submit to build.
The app will be sent to the given email address
Now download the file and install it as shown in Figure 5.14.

Figure 5.14
5.2.2 Raspberry pi auto login
The requirement in the project is to make Raspberry pi login and execute the script automatically after it finish up the boot process. To accomplish this certain settings needs to be done.
Raspberry pi asks for Login and password after booting

Figure 5.15
As a default raspberry pi login is pi and password is raspberry, But in order to execute python script in the start automatically raspberry pi should auto login.
In order to make raspberry pi auto login following steps should be followed.
After raspberry pi finish the boot type this command Sudo nano /etc/inittab
Now scroll down to the following command
1:2345:respawn:/sbin/getty –noclear 38400 tty1
Add # in the start of the command to make it comment as
#1:2345:respawn:/sbin/getty –noclear 38400 tty1
Now add this command underneath
1:2345:respawn:/bin/login -f pi tty1 </dev/tty1 >/dev/tty1 2>&1
The file will look like as shown in Figure 5.16

Figure 5.16
Save the file and exit [10].
Reboot raspberry pi and it will auto login.
5.2.3 Executing python script in start
Python script needs to be executed right after raspberry finishes its boot. To make certain script execute in the start follow the underlying steps.
After raspberry finish up the booting type Sudo nano /etc/rc.local
Now add the python file name and directory which is required to be executed before exit 0.

In this project 2 files are executing in the start.

Do not forget to add “&” in the end of file directory otherwise raspberry pi will not reboot and will run in never ending loop [11]. Save and exit the file and reboot the raspberry pi, now it will execute the file right after the boot.
Chapter 6
Results
The aim of this project is to make the basic environmental factors accessible on internet which are vital for agriculture. To achieve this goal, standalone system has been planned and the most important was to make it power efficient. Power efficiency have been achieved in this project using effective programming. In this part of the project temperature and humidity has been obtained from the field using temperature and humidity sensors by interfacing it with microcontroller, this data serially communicated to RTU terminal of the Xbee pro.
After receiving the data at RTU end, RTU Encodes the data into API frame to make it secure and transmit to MTU of Xbee pro .The wireless communication results using Xbee pro has been observed with 100% success rate. MTU of Xbee pro is interfaced with Arduino microcontroller, which receives the data serially from MTU. Arduino is a central controlling device in this project, it is bringing in efficiency by carefully turning on and off devices which consumes high power.
Raspberry pi and Hotspot turbo stick are high power consumption devices. Raspberry pi is connected with Arduino microcontroller and communicates the data serially. Data received at Raspberry pi is encoded into API frame, Raspberry pi decodes the data and takes the desired data by picking up the right bits and combine them. In addition to that this data is also converted into humidity and temperature using formulas. This data then uploaded onto webservers, in this project www.data.sparkfun.com servers has been used as shown in Figure 6.1. It can store the data up to 100 Mb for free. The coding has been attached in Appendix.

Figure 6.1 Data
In this part of project Humidity and temperature has been uploaded but more entities can be added by following the same method described in chapter 5. This data can be accessed from internet browser. Moreover, this data has been made more accessible by exhibiting on android app as shown in Figure 6.2.

6.1 Cost
The total costs of the devices used in this part of the project are less than 150$ which makes it extremely affordable. New models of raspberry pi has been flooded in the market after the success of its initial models but the raspberry used in this project can be bought for around $25.
The RF module used in this Project to communicate data is Xbee pro; Xbee pro has higher range than the regular models. The price of this module with its board is around $85.
Arduino mega 2560 has been used in the project it is equipped with 3 serial ports which makes it more preferred choice when it needs to communicate with more than one device. Arduino mega 2560 is a board equipped with microcontroller and besides all the qualities it is very cheap on price, it costs around $20.
Relay module has been used to provide the power to the raspberry pi and USB WI-FI hotspot stick. This relay module costs $5.
HUAWEI LTE E8372 Hotspot Turbo Stick is provided by the Bell network for free with a 2 year contract. TP-Link TL-WN725N has been used as USB WI-FI adapter and costs around $11.
6.2 Power consumption
6.2.1 Raspberry pi
The most power consuming device in this project is raspberry pi. Raspberry pi takes almost 1A current at 5V input. So in order to minimize the power usage in the project raspberry pi is left turned off until data needs to be uploaded to the webserver.
6.2.2 Xbee pro
Xbee pro power consumption is not high. It’s maximum when it is transmitting soar up to 250mA to 300mA. In hibernation mode its power depends upon SM selection as shown in Figure 6.1 [12].

Figure 6.3 Xbee
6.2.3 Arduino Mega 2560
Arduino mega 2560 power consumption is very low. It operates at 5V and its output current limit on each pin is 20mA. The maximum current it can draw using all pins activated at single time would add up current to 800mA but in this project only 2 I/O pins have been used, so the total power consumption in this case is very low [13].
6.2.4 HUAWEI LTE E8372 Hotspot stick
This hotspot stick consumption is high, it operates at 5V and takes 750mA. Because of high power consumption, this device turns on along with raspberry pi only when data needs to be uploaded to the webserver [14].
Chapter 7
Conclusions and Future work
Population of world increasing by each passing day so the agricultural sector is under pressure to produce more than ever. More advanced approaches are now being practice to maximize the output of crops. A lot of research has been taking place to find out new and improved methods of agriculture. In this project, struggle have been made to increase the output of crops by monitoring the environmental factors carefully.
In this part of the project, two perimeters temperature and humidity have been successfully communicated and uploaded on to the internet. Furthermore, the project has been successfully made power efficient by effective programming. The cost of the project is the most critical part, so each device has been used in the project carefully chosen to serve the purpose and yet cheap on price.
For the future work, more aforementioned environmental factors will be added water level, sun light intensity, and wind speed. To make it stand alone system, Solar panel and battery backup will be installed. The selection of solar panel and battery backup will be critical so it can supply the power to the unit seamlessly.
The data uploaded to the server in this project is www.data.sparkfun.com this is free website but personnel and improved servers can be used to upload this data and by programming it can be achieved to send email if any of the environmental factor shows emergency situation. To transmit the data Xbee Pro RF module has been used but for more distant areas different devices can be chosen and design of directional antennas can accomplish extended range.
Appendix
Coding of Raspberry pi




Each coding command has been explained in the comments. Comments have been mentioned in green color [15][16][17][18][19][20][21][22][23][24][25][26][27][28][29][30][31].
ARDUINO MEGA 2560


Each coding command has been explained in the comments.
if (z[n]==1 && z[n+1]==1 && z[n+15]==1 && k<1)
This command has been used because while reading an input value at pin 7 from raspberry pi there has been a lot of garbage value being recorded, so to make it more resistant to floating values this condition has been introduced.
References
[1] “Estimates of population, Canada, provinces and territories”. Statistics Canada. December 18, 2013
[2] “The Effect of Temperature on Plant Growth”. June 1953.” Annual Review of Plant Physiology”. Vol. 4:347-362.
[3] E.-D. Schulze, R. H. Robichaux.(1987). “Plant Water Balance”. American Institute of Biological Sciences.DOI: 10.2307/1310175.
[4] Kopetz, Hermann. Real-time systems: design principles for distributed embedded applications. New York: Springer, 2011.
[5] Arouje, Sony. “Connecting XBee to Raspberry Pi – DZone IoT.” Dzone.com. October 24, 2016. Accessed May 12, 2017. https://dzone.com/articles/connecting-xbee-raspberry-pi.
[6] “Savage.home.automation.” SHA – – – Raspberry Pi – RS232 Serial Interface Options (Revisit). Accessed May 12, 2017. http://www.savagehomeautomation.com/projects/raspberry-pi-rs232-serial-interface-options-revisit.html.
[7] “Raspberry Pi and the Serial Port.” English Website. Accessed May 12, 2017. http://www.hobbytronics.co.uk/raspberry-pi-serial-port.
[8] Raspberry Pi • View topic – How to use serial TX/RX on GPIO?? Accessed May 12, 2017. https://www.raspberrypi.org/forums/viewtopic.php?f=44&t=97134.
[9] “Raspberry Pi and Arduino Connected Over Serial GPIO.” Oscar Liang. May 20, 2015. Accessed May 12, 2017. https://oscarliang.com/raspberry-pi-and-arduino-connected-serial-gpio/.
[10] “RPi Debian Auto Login.” RPi Debian Auto Login – eLinux.org. Accessed May 12, 2017. http://elinux.org/RPi_Debian_Auto_Login.
[11] “Rc.local.” Rc.local – Raspberry Pi Documentation. Accessed May 12, 2017. https://www.raspberrypi.org/documentation/linux/usage/rc-local.md.
[12]”XBee Datasheet” Accessed May 12, 2017. https://www.sparkfun.com/datasheets/Wireless/Zigbee/XBee-Datasheet.pdf
[13] Arduino – ArduinoBoardMega2560. Accessed May 12, 2017. https://www.arduino.cc/en/Main/ArduinoBoardMega2560.
[14]”Huawei Quick Start Guide”, Accessed May 12, 2017. https://images.wirelessdealer.ca/images/phones/userguide3967.pdf
[15] “1.10. Input and Output¶.” 1.10. Input and Output — Hands-on Python Tutorial for Python 3.1. Accessed May 12, 2017. http://anh.cs.luc.edu/python/hands-on/3.1/handsonHtml/io.html.
[16] “Reading data from external device.” Python – Reading data from external device – Raspberry Pi Stack Exchange. Accessed May 12, 2017. http://raspberrypi.stackexchange.com/questions/15615/reading-data-from-external-device.
[17] Raspberry Pi • View topic – simple serial port data logger. Accessed May 12, 2017. https://www.raspberrypi.org/forums/viewtopic.php?t=64545&p=644212.
[18] “Getting started with pySerial.” Zilogic Systems- Getting Started with pySerial. Accessed May 12, 2017. http://www.zilogic.com/blog/tutorial-pyserial.html.
[19] “Can’t Get Raspberry Pi and Xbee to Work Together.” Python – Can’t Get Raspberry Pi and Xbee to Work Together – Electrical Engineering Stack Exchange. Accessed May 13, 2017. http://electronics.stackexchange.com/questions/65263/cant-get-raspberry-pi-and-xbee-to-work-together.
[20] “PySerial and reading binary data.” Stack Overflow. Accessed May 13, 2017. http://stackoverflow.com/questions/7640993/pyserial-and-reading-binary-data.
[21] “How do I convert hex to decimal in Python?” How do I convert hex to decimal in Python? – Stack Overflow. Accessed May 13, 2017. http://stackoverflow.com/questions/9210525/how-do-i-convert-hex-to-decimal-in-python.
[22] “Hexadecimal string to byte array in python.” Bytearray – hexadecimal string to byte array in python – Stack Overflow. Accessed May 13, 2017. http://stackoverflow.com/questions/5649407/hexadecimal-string-to-byte-array-in-python.
[23] “Merge two integers in Python.” Stack Overflow. Accessed May 13, 2017. http://stackoverflow.com/questions/12838549/merge-two-integers-in-python. [24] “Calculating the Checksum of an API Packet.” Kb. Accessed May 13, 2017. http://knowledge.digi.com/articles/Knowledge_Base_Article/Calculating-the-Checksum-of-an-API-Packet.
[25] “Why doesn’t this division work in Python?” Numbers – Why doesn’t this division work in Python? – Stack Overflow. Accessed May 13, 2017. http://stackoverflow.com/questions/1787249/why-doesnt-this-division-work-in-python.
[26] “2. Built-in Functions¶.” 2. Built-in Functions — Python v3.1.5 documentation. Accessed May 13, 2017. https://docs.python.org/3.1/library/functions.html.
[27] “Convert hex string to int in Python.” Stack Overflow. Accessed May 13, 2017. http://stackoverflow.com/questions/209513/convert-hex-string-to-int-in-python.
[28] “Python integer to hexadecimal extra characters.” Hex – Python integer to hexadecimal extra characters – Stack Overflow. Accessed May 13, 2017. http://stackoverflow.com/questions/10218164/python-integer-to-hexadecimal-extra-characters.
[29] “How to open a url in python.” Bottle – how to open a url in python – Stack Overflow. Accessed May 13, 2017. http://stackoverflow.com/questions/4302027/how-to-open-a-url-in-python.
[30] MrLeeh. “Raspberry Pi Shutdown Button.” Instructables.com. May 12, 2016. Accessed May 13, 2017. http://www.instructables.com/id/Raspberry-Pi-Shutdown-Button/step4/Raspberry-Pi-Shutdown-script/.
[31] Gordons Projects. Accessed May 13, 2017. https://projects.drogon.net/raspberry-pi/gpio-examples/tux-crossing/gpio-examples-1-a-single-led/.
Figure references
“Raspberry Pi launched.” Visit timfrantic’s website. Accessed May 13, 2017. http://www.timrileydigital.com/phddiary/raspberry-pi-launched. /
Figure 2.1
http://computerlearnhow.com/wp-content/uploads/2012/05/Pi-diagram.jpg Figure 2.2
https://s-media-cache-ak0.pinimg.com/originals/95/30/46/953046f96aeb9ab53eb91abff2b24bc8.jpg Figure 2.3
https://refrobot.files.wordpress.com/2014/01/xbee-proc2ae-868z.jpg
Figure 2.4
http://pic-microcontroller.com/wp-content/uploads/2015/06/Interfacing-xbee-with-PIC-microcontroller-using-MikroC.jpg
Figure 2.5
https://svetelektro.com/Pictures/vf/xbee/uart_prenos.png
Figure 2.6
http://thomarmax.github.io/QtXBee/doc/pre_alpha/api-frame-escape-mode.png Figure 2.7
http://www.electroschematics.com/wp-content/uploads/2013/01/Arduino-Mega-2560-Pinout.jpg
Figure 2.8
https://www.google.ca/url?sa=i&rct=j&q=&esrc=s&source=images&cd=&ved=0ahUKEwjW2sWk3szQAhWh24MKHRXFDLMQjBwIBA&url=https%3A%2F%2Fforum.arduino.cc%2Findex.php%3Faction%3Ddlattach%3Btopic%3D125908.0%3Battach%3D26850&psig=AFQjCNE_kemofnmWCwpYWEAlgO0AyleXRA&ust=1480466618816568
Figure 2.9
http://support.bell.ca/Styles/wireless/all_languages/all_regions/catalog_images/large/mobile/front/Huawei_E8372_lrg1.png
Figure 2.10
http://brilliantlyeasy.com/wp-content/uploads/2014/03/linux_tl-wn725n-howto.jpg
Figure 2.11
http://www.buildyourowndrone.co.uk/media/catalog/product/cache/1/image/9df78eab33525d08d6e5fb8d27136e95/X/B/XBEE-RPSMA-2_2.jpg
Figure 3.1
http://artofcircuits.com/wp-content/uploads/2014/05/2-ch-relay-module-1.jpg Figure 3.5
http://42bots.com/wp-content/uploads/2015/03/GUI.jpg
Figure 4.1
http://static1.1.sqspcdn.com/static/f/1127462/20698433/1350791143717/serial-inittab.png?token=mNMa13YSBD0DL%2BEQ81VfhrioH1w%3D
Figure 4.2
https://www.google.ca/url?sa=i&rct=j&q=&esrc=s&source=images&cd=&ved=0ahUKEwjAm96p5czQAhXL1IMKHapwD60QjBwIBA&url=https%3A%2F%2Ffarm1.staticflickr.com%2F482%2F19919928911_4e5a3b05f7_o_d.png&psig=AFQjCNEjWzoqMQjXrWhz6E8mRND9CYGrTQ&ust=1480468557459608
Figure 4.3
https://www.google.ca/url?sa=i&rct=j&q=&esrc=s&source=images&cd=&ved=0ahUKEwjHyaza5szQAhUF3YMKHa9jCq0QjBwIBA&url=https%3A%2F%2Fwww.netsoup.net%2Fdocs%2Fraspberry-pi%2Fusage%2Fminecraft%2Fimages%2Fapp-menu-python2.png&psig=AFQjCNGsrWrReqMJcwzVPQFYMk-uCbzyrg&ust=1480468936779251
Figure 5.2
https://www.jeremymorgan.com/images/raspberry-pi-programming-python-1.png
Figure 5.3
https://www.jeremymorgan.com/images/raspberry-pi-programming-python-3.png
Figure 5.4
https://www.sparkfun.com/datasheets/Wireless/Zigbee/XBee-Manual.pdf
Figure 6.3
Table references
DIGI Xbee/Xbee- PRO 868 RF Module user guide
Table 2.1, Table 2.2.
Arduino Mega 2560 Data sheet by ManTech
Table 2.3
322.
Takata, T., and Ishikawa, F. (2003). Human Sir2-related protein SIRT1 associates with the bHLH repressors HES1 and HEY2 and is involved in HES1- and HEY2-mediated transcriptional repression. Biochem Biophys Res Commun 301, 250-257.
Tao, R., Coleman, M.C., Pennington, J.D., Ozden, O., Park, S.H., Jiang, H., Kim, H.S., Flynn, C.R., Hill, S., Hayes McDonald, W., et al. (2010). Sirt3-mediated deacetylation of evolutionarily conserved lysine 122 regulates MnSOD activity in response to stress. Molecular cell 40, 893-904.
Tao, R., Vassilopoulos, A., Parisiadou, L., Yan, Y., and Gius, D. (2014). Regulation of MnSOD enzymatic activity by Sirt3 connects the mitochondrial acetylome signaling networks to aging and carcinogenesis. Antioxid Redox Signal 20, 1646-1654.
Vassilopoulos, A., Pennington, J.D., Andresson, T., Rees, D.M., Bosley, A.D., Fearnley, I.M., Ham, A., Flynn, C.R., Hill, S., Rose, K.L., et al. (2014). SIRT3 deacetylates ATP synthase F1 complex proteins in response to nutrient- and exercise-induced stress. Antioxid Redox Signal 21, 551-564.
Vaziri, H., Dessain, S.K., Ng Eaton, E., Imai, S.I., Frye, R.A., Pandita, T.K., Guarente, L., and Weinberg, R.A. (2001). hSIR2(SIRT1) functions as an NAD-dependent p53 deacetylase. Cell 107, 149-159.
Vera-Ramirez, L., Sanchez-Rovira, P., Ramirez-Tortosa, M.C., Ramirez-Tortosa, C.L., Granados-Principal, S., Lorente, J.A., and Quiles, J.L. (2011). Free radicals in breast carcinogenesis, breast cancer progression and cancer stem cells. Biological bases to develop oxidative-based therapies. Crit Rev Oncol Hematol 80, 347-368.
Vitek, W.S., Shayne, M., Hoeger, K., Han, Y., Messing, S., and Fung, C. (2014). Gonadotropin-releasing hormone agonists for the preservation of ovarian function among women with breast cancer who did not use tamoxifen after chemotherapy: a systematic review and meta-analysis. Fertil Steril 102, 808-815 e801.
Wang, M., Kirk, J.S., Venkataraman, S., Domann, F.E., Zhang, H.J., Schafer, F.Q., Flanagan, S.W., Weydert, C.J., Spitz, D.R., Buettner, G.R., et al. (2005). Manganese superoxide dismutase suppresses hypoxic induction of hypoxia-inducible factor-1alpha and vascular endothelial growth factor. Oncogene 24, 8154-8166.
Warburg, O. (1956). On the origin of cancer cells. Science 123, 309-314.
Wilking-Busch, M.J., Ndiaye, M.A., Huang, W., and Ahmad, N. (2017). Expression profile of SIRT2 in human melanoma and implications for sirtuin-based chemotherapy. Cell Cycle 16, 574-577.
Xiong, Y., Wang, M., Zhao, J., Wang, L., Li, X., Zhang, Z., Jia, L., and Han, Y. (2017). SIRT3 is correlated with the malignancy of non-small cell lung cancer. Int J Oncol 50, 903-910.
Yu, W., Denu, R.A., Krautkramer, K.A., Grindle, K.M., Yang, D.T., Asimakopoulos, F., Hematti, P., and Denu, J.M. (2016a). Loss of SIRT3 Provides Growth Advantage for B Cell Malignancies. J Biol Chem 291, 3268-3279.
Yu, W., Dittenhafer-Reed, K.E., and Denu, J.M. (2012). SIRT3 protein deacetylates isocitrate dehydrogenase 2 (IDH2) and regulates mitochondrial redox status. J Biol Chem 287, 14078-14086.
Yu, Y., Liu, Y., Zong, C., Yu, Q., Yang, X., Liang, L., Ye, F., Nong, L., Jia, Y., Lu, Y., et al. (2016b). Mesenchymal stem cells with Sirt1 overexpression suppress breast tumor growth via chemokine-dependent natural killer cells recruitment. Sci Rep 6, 35998.
Yu, Y., Zhang, Q., Meng, Q., Zong, C., Liang, L., Yang, X., Lin, R., Liu, Y., Zhou, Y., Zhang, H., et al. (2016c). Mesenchymal stem cells overexpressing Sirt1 inhibit prostate cancer growth by recruiting natural killer cells and macrophages. Oncotarget 7, 71112-71122.
Zhou, W., Ni, T.K., Wronski, A., Glass, B., Skibinski, A., Beck, A., and Kuperwasser, C. (2016). The SIRT2 Deacetylase Stabilizes Slug to Control Malignancy of Basal-like Breast Cancer. Cell Rep 17, 1302-1317.
Zhu, Y., Park, S.H., Ozden, O., Kim, H.S., Jiang, H., Vassilopoulos, A., Spitz, D.R., and Gius, D. (2012). Exploring the electrostatic repulsion model in the role of Sirt3 in directing MnSOD acetylation status and enzymatic activity. Free Radic Biol Med 53, 828-833.
Zhu, Y., Yan, Y., Principe, D.R., Zou, X., Vassilopoulos, A., and Gius, D. (2014). SIRT3 and SIRT4 are mitochondrial tumor

Figure 6.7 – Different concrete grades with 20% replacement of natural aggregate with tile aggregate and their respective compressive strength at 7 & 28 days.

FIGURE 6.8 – Different Concrete Grade with 20% replacement of natural aggregates with tile aggregates represents their obtained compressive strength against their Required Target Mean Strength
- Here, M 20 & M 25 show acceptable strength but M 30 has lower strength than required. So, M 30 is rejected.
CONCLUSION AS PER 1ST CRITERIA
All the batches of M 20 grade concrete containing tile aggregates upto 20% satisfy the required strength. Beyond that compressive strength decreases gradually with increase the proportion of tile aggregates in concrete. Hence, it is possible to replace upto 20% tile aggregates with normal coarse aggregates in M 20 grade concrete.
Similarly, for M 25 grade concrete compressive strength decreases with increase in tile aggregates in concrete in all batches. Upto 20% replacement it meets the required conditions.
M 30 grade concrete should possess high compressive strength as compare to M 20 and M 25. As it can be observed in results that with 5% replacement of aggregates it does not meets the required conditions. Therefore it is not possible to substitute the natural aggregates with tile aggregates in any proportion of M 30 grade concrete.
CHEACKING OF CONCRETE RESULTS AS PER 2nd CRITERIA
Therefore, for M 20
| Specified grade | Mean of the group of 4 non-overlapping consecutive test results in N/mm2 | Individual test results in N/mm2 |
| M 20 | 20 + 0.825 × 4 = 23.30
Or 20 + 4 = 24 24 > 23.3 Hence, acceptance value is 24. |
20 – 4 = 16 |
For M 25
| Specified grade | Mean of the group of 4 non-overlapping consecutive test results in N/mm2 | Individual test results in N/mm2 |
| M 25 | 25 + 0.825 × 4 = 28.30
Or 25 + 4 = 29 29 > 28.30 Hence, acceptance value is 29. |
25 – 4 = 21 |
For M 30
| Specified grade | Mean of the group of 4 non-overlapping consecutive test results in N/mm2 | Individual test results in N/mm2 |
| M 30 | 30 + 0.825 × 5 = 34.125
Or 30 + 4 = 34 34.125 >34 Hence, acceptance value is 34.125 |
30 – 4 = 26 |
CONCLUSION AS PER 2nd CRITERIA
It is clear from the above tables that strength required for 2nd criteria of acceptance of concrete is lower than the 1st criteria, therefore all concrete mixes accept the 2nd criteria automatically except M 30 grade concrete containing 20% replacement of normal aggregates with tile aggregates which fails in both acceptance criteria of concrete.
6.2 COST ANALYSIS
Total cost of 20 mm aggregates to prepare 1 m3 M 20 grade concrete –
Total volume of aggregates in M 20 concrete = 0.691 m3
Total volume of coarse aggregates = 62 % of 0.691
Therefore, 62% of 0.691 = 0.428 (10 mm + 20 mm both)
Volume of 20 mm aggregates in total coarse aggregates = 40%
40% of 0.428 = 0.171 m3
Now,
Price of 1 m3 of 20 mm natural aggregates = Rs. 1175 (as per CPWD rate analysis 2014)
Price of 0.171 m3 20 mmnatural aggregates = 1175 × 0.171
= Rs. 200
Now, Total saving by substituting natural aggregate with tile aggregate in M 20 concrete –
Volume of 20 mm aggregates after 20 % replacement with tile aggregates
= 20/100 × 0.171 = 0.0342 m3
= 0.171 – 0.0342 = 0.1368 m3
Price of 0.1368 m3 of aggregates = Rs.162
Total saving on 1m3 M 20 grade concrete by replacing 20% tile aggregates with normal aggregates = 200 – 162 = Rs. 32
Hence, total saving on aggregates in terms of rupees to produce 1 m3 of M 20 grade concrete by using tile aggregates = 16%
(Without including labor and transportation charges)
CRUSHING COST OF TILES –
Machine Model Φ400×400 specification –
- Manufacturer = ALPU
- Price = Rs. 50000 approx.
- Rotor speed = 1500 rpm
- Input opening size = 145 × 450 mm
- Discharge size = 0 – 30 mm
- Capacity = 5 – 8 tons/hour
- Power = 7.5 kw
- Weight = 0.9 ton
- Overall dimensions = 844×942×878 mm (L×W×H)

FIGURE 6.9 CRUSHING MACHINE
Crusher machine price = Rs. 50000 – 1000000
(depends upon capacity of machine)
Operating cost of machine per hour = power × per unit electricity cost
= 7.5 ×7 = Rs. 52.50
Output per hour = 5 to 8 tons of tile aggregates
As a result, at the cost of rupees 52.50, 5 to 8 tons of tile aggregates can be obtained which is sufficient to be used in large quantity of concrete. So, tile crushing cost is negligible.
6.3 SUMMARY
In this chapter experimental results have been discussed. In addition to this the cost analysis of aggregates has also been presented.
CHAPTER – 7
Conclusions
7.1 CONCLUSIONS
It is very much essential and important to find solution for construction waste and to find alternatives for natural raw materials of construction. As population is increasing day by day, demand of aggregates in concrete is also increasing. Simultaneously, concrete waste production is increasing. So the best solution for both of the problems is to reuse such waste in concrete production.
- Ceramic tile aggregate is an appreciated and appropriate concrete material for substitution into concrete composition based on its properties.
- Mechanical properties of ceramic aggregate are similar to the natural aggregate and its behavior is similar but not same. Water absorption, crushing value and impact value, are higher than natural coarse aggregate and lower by specific gravity i.e. 2.24 g/cm3 .
- It is possible in M 20 grade concrete to substitute 20% of normal 20 mm aggregates with ceramic tile aggregates without compromising its required compressive strength.
- For all concrete mixes (M 20, M25, M30) compression strength of concrete decreases with increase in the proportion of replacement of natural aggregates with tile aggregates which is due to low specific gravity higher porosity of tile aggregates as compare to natural aggregates.
- In M 30 grade concrete with 5% substitution of tile aggregates its strength decreases from 38.73 to 36.73 n/mm2, which is less than target mean strength. So, as per results substitution should be avoided for this grade of concrete. M 20 and M 25 concretes are suitable for the replacement of aggregates.
- Tile aggregate concrete is little bit more economical as compare to conventional concrete. As an estimate for making 1 m3 of concrete by substituting 20% normal 20 mm aggregates with tile aggregates about 16% money can be saved on total amount of 20 mm aggregates.
- By addition of ceramic tile waste into concrete, proper effective utilization of ceramic tile waste can be achieved.
7.2Scope for Further Studies –
- In this experimental study only compression strength has been checked, effect on tensile strength and flexural strength of concrete with inclusion of tile aggregates can be investigated.
- Although by decreasing the water/cement ratio, high strength concrete can be obtained. But the workability will be very low. As in this study the required workability is achieved by using maximum water cement ratio. Therefore, it is recommended that adding admixtures such as super plasticizer and silica fume into the mixing so that the workability will be improved.
- More trials with different particle sizes of tile aggregate and percentage of replacement of natural aggregate are recommended to get different outcomes and higher strength characteristics in concrete.
BIBLIOGRAPHY
- Advanced Construction Technology System –ACTSBy P. G. Ioannou,1 A.M. ASCE, and L. Y. Liu,2 A.M. ASCE.
- Binici, Effect of crushed ceramic and basaltic pumice as fine aggregates on concrete mortars properties, Construction and Building Materials 21 (2007) 1191–1197.
- Brito J.de., Pereira A.S., Correia J.R., (2005), Mechanical behaviour of non-structural concrete made with recycled ceramic aggregates, Cement & Concrete composites, pp 429-433.
- Concrete Technology by M. S. Shetty S. Chand Publishing, page no. 66 – 118.
- DUET Journal “Effect of Replacing Natural Coarse Aggregate by Brick Aggregate on the Properties of Concrete” Vol. 1, Issue 3, June 2012.
- Freedonia world construction aggregates industry study
- International Journal of Civil Engineering Research,ISSN 2278-3652 Volume 5, Number 2 (2014), pp. 151-154,© Research India Publicationshttp://www.ripublication.com/ijcer.htm
- International Journal of Civil Engineering Research. ISSN 2278-3652 Volume 5, Number 2 (2014), pp. 151-154.
- IS 10262:2009, Indian standard concrete mix proportioning – Guidelines (First revision), Bureau of Indian Standards, New Delhi, India
- IS 383 : 1970, Specifications for Coarse and Fine Aggregates from Natural Sources for Concrete ( second Revision) Bureau of Indian Standards, New Delhi, India.
- IS 456 : 2000, Plain and Reinforced Concrete – Code of Practice (fourth Revision) Bureau of Indian Standards, New Delhi, India.
- IS 516 : 1959, Methods of Tests for Strength of Concrete, Bureau of Indian Standards, New Delhi, India.
- Journal for scientific and Industrial Research, Vol. 70, May 2011, pp.385-390.
- Koyuncu, Y. Guney, G. Yilmaz, S. Koyuncu, R. Bakis, Utilization of Ceramic Wastes in theConstruction Sector, Key Engineering Materials Vols. 264-268 (2004) pp 2509-2512.
- Mohd Mustafa Al Bakri, H. Kamarudin, Che Mohd Ruzaidi, Shamsul Baharin, R. Rozaimah, Nur Khairiatun Nisa. Concrete With Ceramic Waste and Quarry Dust Aggregates. 5th Annual Conference Management in Construction Researchers Association, 2006: 383-388
- Mohini Saxenaa, & Shyam R. Asolekar – Solid wastes generation in India and their recycling potential in building materials.
- Pacheco-Torgal, S. Jalali, Reusing ceramic wastes in concrete, Construction and Building Materials 24 (2010) 832–838.
- Wattanasiriwech, A. Saiton, S. Wattanasiriwech, Paving blocks from ceramic tilec production waste, Journal of
.001
.962
Reject
H6: Exchange rate has positive impact on FDI
-.125
.000
Reject
H7: Interest rate has negative impact on FDI
.045
.003
Reject
CHAPTER 5:
DISCUSSION, CONCLUSION, IMPLICATIONS AND FUTURE RESEARCH
5.1 Conclusion
Foreign direct invest being the most important factor in the development of developing countries likewise Pakistan. From recent years there has been great fight going on among LDC’s from all over the world to attract higher amount of FDI to fuel their economic growth. This research was intended to find out the impact of macroeconomic variables including GDP, GDP per capita growth rate, Interest rate, Inflation rate, Wage rate, Exchange rate, Tax rate and Infrastructure expenditure (PSDP fund) on the inflow of Foreign Direct Investment in Pakistan.The relationship between labor cost (Wage) and FDI could not be established because insufficient data was available on the annual wage rate in the country. GDP, GDP per capita growth rate and Tax rate were statistically insignificant in contributing in the final model.The most significant variables in the model were Inflation rate and Exchange rate; both had negative relation with FDI inflow having beta of -8.806 and-5.646 respectively.Interest rate and Infrastructure expenditure (PSDP fund) were positively related with FDI inflow having beta of 2.047 and 1.654 respectively.
5.2 Discussion
Accordingto results derived from the research inflation had negative impact on FDI as found by (Kok and Erosy, 2003). Contradictory to the studies of Kok and Erosyet al. andAsiedu (2002) that found positive impact of GDP per capita growth rate on inward flow of FDI but in case of Pakistan GDP per capita growth rate proved insignificant.Results regarding the impact ofinfrastructure on FDI were similar to those established by Asiedu (2002)but the impact of tax rate was conflicting. The results regarding the impact of exchange rate on FDI were consistent with those found by (Cushman,1985).Terpstra and Yu (1988) and Weinstein (1977) found positiveimpact of GDP on FDI but according to the results of this study GDP was statistically insignificant in explaining variation in FDI.Finally, the results regarding the impact of interest rate on FDI were consistent with those found by (Fernandez-Arias, 1996).
5.3 Implications and Recommendations
Pakistan belongs to category of countries those currently face huge deficit of resources to finance its major growth projects and to manage the government operations smoothly.This research paper made attempt to explore those factors that in particular have direct impact on the inward FDI flow of the country.Results of the research show that exchange rate and inflation were negatively related with FDI and had statistically significant impact on the FDI received by the country. Therefore, the government of Pakistan should try to control the rate of inflation and fluctuations in the exchange rate and keep it at minimum possible level inorder to assist the increase in inflow flow of FDI.Similarly, infrastructure expenditure and interest rate were found to be positively related with inflow of FDI, keeping this in mind government should increase its spending on the development of infrastructure within the country. Following these strategies the government would be able to attract higher amount of FDI.
5.4 Future Research
Generally speaking determinants of foreign direct investment could consist of variety of factors other than some macroeconomic variables discussed in this particular research paper. The most common of those that previously have been studied were political factors including political stability, level of corruption, structure of the industry, market openness and variety of other factors impact the foreign direct investment received by any specific country. But talking in the Asian scenario cheap labor has been one of the major determinants of the inward FDI flow but unfortunately data regarding labor cost (wage) could not be collected and the impact of labor cost on FDI in case of Pakistan remained unidentified. Therefore, great deal of research could be done in order to identify those variables
delivery modality (text presentation) for both lists. In all the previous studies the older adults were told to read the words aloud in the study sessions. Auditory perceptual processing may be more impaired than visual perceptual processing which would explain why other studies showed a supposed “recollection-specific” deficit but the current study did not. The current study also had a larger group of older adults than most previous studies and a more representative sample of older adults than most previous studies. Therefore, the lack of recollection-specific deficit in the current study casts some doubt upon Jacoby’s assumption that memory processes are neatly divided into recollection and familiarity components and that recollection is impaired while familiarity is spared.
5.0 CORRELATIONAL ANALYSIS OF BEHAVIORAL EXPERIMENTS
Many of the same participants participated in all three behavioral experiments. Correlational analyses were conducted to determine if there were patterns of performance across the experiments. Reaction times were highly correlated across all three experiments for both older and young adults (see Table 1). The proportion of correct responses was significantly correlated for Experiments 1 & 3 for older adults (R=.555, p<.001) and marginally correlated for Experiments 1 & 2 (R=.331, p-.069) and for Experiments 2 & 3 (R=.259, p=.075). The proportion of correct responses was significantly correlated for Experiments 1 & 3 (R=.511, p=.006) and for Experiments 2 & 3 (R=.292, p=.009) and marginally correlated for Experiments 1 & 2 (R=.344, p=.073). Thus, based on correct responses and reaction times, individuals’ performance was quite consistent across the three experiments. An additional analysis compared the magnitudes of the age-related effects across experiments to determine whether the hypothesized age effects in each task were associated with the same underlying mechanisms. Significant correlations would suggest that similar cognitive processes were being measured in each experiment.
The measures used to represent the specific age-related impairment in each experiment were based on the predictions of each experiment. For Experiment 1, the difference in old/new discrimination (hits-lure false alarms) between pictures and words was used as a measure of age- related impairment (perceptual processing impairment). Age-related impairment should
correspond to a greater difference in discrimination between pictures and words. For Experiment 2, the level of old/new discrimination (hits-false alarms) in the “List 1 & 2 Exact” condition represented the ability of older adults to use associative information. Age-related impairment should correspond to worse discrimination in this task. For Experiment 3, discrimination in the “exclusion” task was used (hits-false alarms to List 1 items). Age-related impairment should correspond to worse discrimination in this task. Only Experiments 1 and 2 were significantly correlated and only for young adults (R=-.669, p<.001). The negative correlation indicates that a greater benefit in the picture lure condition in Experiment 1 was related to worse pair memory in the “List 1 & 2 Exact” condition in Experiment 2.
The lack of correlation of performance on Experiment 3 with Experiments 1 & 2 is consistent with the finding that there was no specific age-related impairment and with the conclusion that the process-dissociation procedure is not the best method for detecting age- related memory impairments. The lack of correlation between Experiments 1 & 2 suggests that the specific age-related impairments may not have the same underlying causes. The perceptual impairment hypothesis and the associative encoding impairment hypothesis might represent two separate and independent age-related memory impairments. However, it is impossible to draw strong conclusions from the lack of correlation because this lack of correlation might simply reflect the noisiness of the data.
Table 1. Reaction time correlations across Experiments 1, 2, & 3 for older and young adults.
| Group | Experiments | N | Correlation | Significance |
| Exp. 1, 2 | 31 | R = .567 | p = .001 | |
| Old | Exp. 1, 3 | 31 | R = .530 | p = .002 |
| Exp. 2, 3 | 48 | R = .508 | p < .001 | |
| Exp. 1, 2 | 28 | R = .571 | p = .002 | |
| Young | Exp. 1, 3 | 27 | R = .407 | p = .035 |
| Exp. 2, 3 | 78 | R = .554 | p < .001 |
6.0 EXPERIMENT 4
6.1 RATIONALE
Experiment 1 found that older adults had difficulty using perceptual details to distinguish lures from targets, and that this difficulty affected words more than pictures. If there are behavioral differences between older adults and young adults and if cognitive processes are supported by neural processes, then it stands to reason that electrophysiological differences between age groups should also exist for this task. Specifically, there should be differences between age groups in the topography and amplitude of waveforms associated with memory, such as the old/new left parietal effect (Curran & Cleary, 2003; Curran, 2000; Henson, et al., 1999) and the slow-wave late positivity (Ruchkin, et al., 2003). Therefore, the interesting results from Experiment 1 were further supplemented and extended by an event-related potential (ERP) experiment that used the same stimuli and similar experimental paradigm.
6.2 METHODS
6.2.1 Participants
Seventeen healthy older adults were recruited from a healthy older adult participant database at the University of