do not necessarily reflect the views of UKDiss.com.
Histone demethylase JMJD6 regulates cellular proliferation and cell migration in adipose derived mesenchymal stem cells
Abstract
Background: Adipose-derived mesenchymal stem cells (ADSCs) have been extensively explored as a promising therapeutic tool based on its abilities of differentiation, proliferation and migration. The epigenetic mechanisms regulate the fate of mesenchymal stem cells (MSCs) have been described in plenty of studies in the past few years. However, the epigenetic modulation of proliferation and migration of ADSCs is poorly understood.
Results: Here, using siRNA screening and ChIP-qPCR assay, we showed that the histone demethylases JMJD6 plays critical roles in regulates proliferation and migration of ADSCs by removing H4R3me2a on promoter regions of PDEC1 and suppressing the PDEC1 expression. Importantly, Depletion of JMJD6 significantly increased ability of cellular proliferation and motility, which associated with the increase of PDE1C expression and decline of the levels of both cAMP and cGMP. The increased proliferative and migratory phenotype of ADSCs may be reverted by treatment with PDE1C inhibitor, suggesting that JMJD6 attenuates the proliferation and migration of ADSCs as an epigenetic regulator of many related genes, including PDE1C, which some extent partially contribute to the JMJD6-mediated regulation of ADSCs. Taken together, our results indicated the first time that the role of JMJD6 in ADSCs proliferation and migration through modulate PDE1C expression.
Introduction
Mesenchymal stem cells (MSCs) are an admitted cell resource for cell-based therapies and can be isolated from a variety of tissues. As one kind of MSCs, adipose-derived mesenchymal stem cells (ADSCs) display similar properties to bone marrow mesenchymal stem cells (BM-MSCs) including a proliferative potential, broad differentiation plasticity. Recently, ADSCs have been used for several stem cells therapy approaches. However, lack of specific accumulation of ADSCs in injured tissues and limited cell proliferation in repeated subcultures in vitro reduce their therapeutic effects1. The capacities of differentiation, proliferation and migration of ADSCs are the critical factors associated with clinical application. In addition, MSCs can increase their proliferation rate and migratory activity during some pathological conditions caused microenvironment changes and migrate to the damage tissue play a primarily role in tissue repairing2.
It has been universally accepted that epigenetic regulation is inheritable govern in cell-specific gene expression without changing DNA sequence and mediated by chromatin remodeling, DNA methylation, non-coding RNA, and histone modifications, which are elaborately controlled, and influence phenotypic commitment. Among these mechanisms, several present studies have revealed that Histone demethylases play a pivotal role in determination the fate of stem cells, including embryonic development, stem cell self-renewal and MSCs differentiation, by removing methyl groups from various methylated histones that binding to the cell specific genes to induce differentiation toward a specific cell lineage3. Lee and Ye identified KDM4B and KDM6B as a Jumonji-C domain containing histone demethylase display epigenetic regulator function in MSCs osteogenic differentiation through the removal of H3K9me3 and H3K27me3 4,5. Liu have demonstrated that histone demethylase KDM6B enhances osteogenic differentiation and anti-inflammation potentials of MSCs by increasing histone K27 methylation in the IGFBP5 gene promoter6. In addition, another research has revealed that histone demethylase LSD1 facilitates adipocyte differentiation by demethylating H3K4 in promoter sites of Wnt signaling pathway components7.
Since directed migration of ADSCs has critical role in clinical application, understanding the precise mechanisms underlying the specific migration of ADSCs to injury sites have been described in plenty of studies in recent years. These mechanisms can be classified into categories of: (1) chemotactic cytokines stimulate cell recruitment (MCP-1, RANTES, SDF-1, etc.)8,9; (2) member of the integrin family receptors promote cell migration (CD44, CD29, CD47, etc.)10,11; (3) chemokine receptors governing cell mobilization (CCR1, CCR2, CXCR4, etc.)1,12; and (4) growth factors exerted a strong chemotactic stimulus (PDGF, bFGF, HGF, etc.)13,14; But are there more overlooked mechanisms that mediate the process of migration? Despite the substantial progress that driving ADSCs migration have been well identified, however, how these signal networks are epigenetically regulated has not been extensively investigated.
Therefore, to further identify specific histone demethylases which are associated with ADSCs migration, we systemically profiled expression of histone demethylases in ADSCs and conducted RNA interfering screening. We found histone demethylases Jumonji C domain-containing protein 6 (JMJD6) as a key epigenetic regulator impaired the migration of ADSCs. JMJD6, a newcomer of histone demethylases, first described by Bruick15, was found capable of removing methyl groups from histone dimethyl symmetric H4R3 (H4R3me2s) and histone dimethyl asymmetric H4R3 (H4R3me2a)16,17, acting as a transcription regulator as H4R3me2s modification is associated with transcriptional repression and H4R3me2a is correlates with an active gene status18. In our research, knockout JMJD6 expression by shRNA increased migration and cell proliferation of ADSCs in vitro by decreased the demethylation of H4R3me2a on PDE1C promoters.
Materials and Methods
Cell culture and viral Infection
Human Adipose-derived mesenchymal stem cells (ADSCs) was purchased from Sichuan Mesenchymal stem cells bank and cultured in α-MEM (Invitrogen, USA) supplemented with 10% heat-inactivated FBS (Gibco), 2 mM L-glutamine (Gibco), 100 U/ml penicillin (Gibco), and 100 μg/ml streptomycin (Gibco), at 37 °C in a 5% CO2 incubator (SANYO, japan). Cells were passaged with trypsin at 90% confluence, growth medium was changed every 3 days. To generate stably knockdown JMJD6 cell lines, lentiviruses carrying JMJD6 shRNAs were packaged and generated in 293T cells as described previously19,20. ADSCs were infected with the indicated viruses and selected with 1 mg/ml puromycin for 1 weeks. The sequences of shRNAs targeting JMJD6 were:
Sh1 5’-GGAGAGCACTCGAGATGATAG-3’;
Sh2 5’-GGTGGCATGTTGTCCTCAATC-3’;
Sh3 5’-GGGAGACCAAAGTTATCAAGG-3’;
siRNA transfection and migration screening
Transient siRNA transfections were performed using RNAiMAX (Invitrogen). Two days after the transfection, the ADSCs were used for migration assays. To profile histone demethylases genes associated with ADSCs migration, 5×104 siRNA-transfected ADSCs in 0.5 ml suspension were added to upper chamber in triplicate. The chambers (membrane with 8 μm pore size) were placed in a 24-well plate and incubated at 37˚C, with 5% CO2 for 18h. The underside of the chamber was fixed in methanol (Sigma-Aldrich) for 10 min and stained by 0.1% crystal violent (Sigma-Aldrich), Three random fields were filmed by microscopy (Leica) and cells were counted.
The siRNAs sequences were as follows:
KDM3A, 5’-CCGACGTTACCAAGAAGGATCTGAA-3’;
KDM3B, 5’-CCTAGCGATCTTTGTAGAATTTGAT-3’
KDM4A, 5’-CAGCTGCCTTGGATCTTTCTGTGAA-3’
KDM4B, 5’-TCGCCCAACCATGGAAGAATTTAAA-3’
KDM5B, 5’-CAGTTGTGTGGCGGTACCCAGTATT-3’
JMJD6, 5’-GAGGATAACGATGGCTACTCAGTGA-3’;
PHF2, 5’-CAGGTCGACAAATGCTACAAGTGCA-3’
RNA-seq assay
Total RNA was extracted by Trizol (Invitrogen) according to manufacturer’s protocol. Three biological replicates of ADSCs and ADSCs JMJD6-KO cells were used for the RNA-seq. A total of 5 μg RNA of each sample was used to prepare libraries. RNA sequencing was performed using HiSeq 4000 (Illumina) by Novogene.
RNA extraction, RT-PCR and qRT–PCR
The total cellular RNA was extracted from ADSCs performed using RNeasy mini kit (Qiagen). RNA was incubated with DNase I (Invitrogen) to remove genomic DNA contamination. First-strand cDNA was synthesized from total RNA using SuperScript III First-Strand synthesis system (Invitrogen). Reverse transcription-Polymerase chain reactions (RT-PCR) were performed with 10 ng of cDNA in 50 μl reaction volume containing gene-specific primers and Ex-Taq DNA polymerase (Takara). Quantitative reverse transcription-Polymerase chain reactions (qRT–PCR) reactions were performed using Powerup SYBR green master mix (Invitrogen) and 7300 real time PCR system (ABI). The mRNA expression levels were normalized using β-actin RNA as internal control
The qPCR primers were prepared as described previously21:
KDM3A, forward: ACCTGCAGTTATTCTTCAGC; reverse: TAATGCCAGTCCTATGCCAT;
KDM3B, forward: TGTTCCCTGGGGACTCCTCT; reverse: GGGCACTACAGTACAGCTGG;
KDM4A, forward: CCTCACTGCGCTGTCTGTAT; reverse: CCAGTCGAAGTGAAGCACAT;
KDM4B, forward: CGGGTTCTATCTTTGTTTCTCTCACCCG; reverse: AAGGAAGCCTCTGGAACACCTG;
KDM5B, forward: AAGGAAGCCTCTGGAACACCTG; reverse: GCAGAGTCTGGGAATTCACA;
JMJD6, forward: AGGTGGATCACTTGAGGTCA; reverse: CACCACACCTGGCTAATTTT;
PHF2, forward: TCGGCACTTCTCTGTTCTCCC; reverse: AAATCCAGCCCCTCCGTGTC;
β-actin, forward: AGAGGGAAATCGTGCGTGAC; reverse: CAATAGTGATGACCTGGCCGT;
ITGA8, forward: GCTGCTGGGGAGTTTACTGG; reverse: GATGCCATCTGTTCTCCCGTG;
EGR1, forward: AGCCCTACGAGCACCTGAC; reverse: GGTTTGGCTGGGGTAACTG;
G0S2, forward: CGCCGTGCCACTAAGGTC; reverse: GCACACAGTCTCCATCAGGC;
CDKN1C, forward: TGACCTCCTTCAGCGAGTG; reverse: TCGGGACTTCTGCGTCATC;
PSAT1, forward: GGCCAGTTCAGTGCTGTCC; reverse: GCTCCTGTCACCACATAGTCA;
PDE1C, forward: GTGACTGAGCAACCATAGTGGAC; reverse: TCGCTGGACAATGTCACTCCTG;
GDF15, forward: CTCCAGATTCCGAGAGTTGC; reverse: AGAGATACGCAGGTGCAGGT;
VCAM1, forward: GCGGAGACAGGAGACACAGTACTAA; reverse: GAGCACGAGAAGCTCAGGAGAA;
MT1, forward: AGTCTCTCCTCGGCTTGC; reverse: ACATCTGGGAGAAAGGTTGTC;
Western blotting
Total cellular protein was extracted using the cell lysis buffer (Beyotime), and concentrations were determined by BCA protein assay kit (Beyotime). Lysates were loaded in SDS–PAGE gel and electrophoresed. Proteins were transferred from gel to PVDF membrane using a Trans-blot electrophoretic transfer kit (Bio-Rad). Membranes were blocked in 5% skim milk in TBST buffer and incubated with primary antibodies Anti-JMJD6 (1:3000; Santa Cruz), Anti-Histone H4R3me2a (1:3000; Active motif), Anti-HA tag (1:4000; abcam) and Anti-GAPDH (1:4000; abcam). After washing, the membranes were incubated with HRP goat anti-mouse IgG (Beyotime) or HRP goat anti-Rabbit IgG (Beyotime). Membranes were then incubated in BeyoECL plus (Beyotime) and then imaged using ChemiDoc imaging system (Bio-Rad).
Wound healing assay.
6-well cell culture plates were coated with 10 mg/cm2 collagenⅠ(Sigma-Aldrich), 1×106 cells were cultured in pre-coated wells at 37˚C with 5% CO2 for 24 hours. A 200 μl yellow pipette tip was used to scratch the confluent cells monolayer. The mediums were changed with fresh medium and the scratches were analyzed after 10 hours using ImageJ software.
Cell proliferation assay
5000 Cells in 100ul α-MEM with 10% FBS were plated in 96-well cell culture plates. At different time points, 10 ul CCK8 regent (Dojindo) was added to the cell culture medium and incubated at 37˚C with 5% CO2 for 1 hour. The absorbance of cell suspension was measured at 450 nm using a microplate reader (Bio-Rad). Cells number was determined according to the standard curve. For EdU assay, plate the cells on poly-lysine-coated coverslips in a 24-well cell culture plates and incubated at 37˚C with 5% CO2 overnight. 10 μM EdU solution (Invitrogen) was added to the cell culture medium treated for 6 hours. Then coverslips were fixed using 3.7% formaldehyde in PBS and permeabilization by a 0.5% Triton X-100. Added 0.5 ml of Click-it plus reaction cocktail (Invitrogen) to each coverslip and incubated for 30 mins. Hoechst 33342 was used to identify nucleus. Coverslips were treated with mounting media and Imaged by fluorescence microscopy (Leica).
Cell Cycle assay
Cells were resuspended with trypsin, washed in PBS and fixed in cold 70% ethanol at 4°C for 30 minutes. 50µl of 100µg/ml RNase was Added to eliminate RNA. Then cells were incubated with 425 µl cell staining buffer (Biolegend) and 25 µl propidium Iodide solution (Biolegend). Cell DNA contents were analyzed using flow cytometry (FC500, Beckman coulter).
ChIP qPCR
Chromosome immunoprecipitation (ChIP) assays were performed using SimpleChIP plus enzymatic chromatin IP kit (Cell signaling technology). 4 X 106 cells are fixed with 540 μl of 37% formaldehyde to cross-link proteins with DNA. Chromatin was digested with 0.5 μl micrococcal nuclease into 150-900bp DNA/protein fragments. Then 10 μl antibody H4R3me2a (Active motif) was added to the IP sample and the complex co-precipitates was captured by protein G agarose. Cross-links were reversed, and DNA was purified using spin column and proceed for qPCR analysis. The primers used for amplifying the promoter were PDE1C and PSAT1 as follows:
PDE1C primer1 forward, 5’-AGGTGTGGTGTTCATTCCCG-3’ reverse,5’- GATTCGGGGGCCCCATTTAT-3’
PDE1C primer2 forward, 5’-TGGACTTTGTCAGTGGGTGG-3’ reverse,5’- TACAGTATGGGGGTGGGACC-3’
PDE1C primer3 forward, 5’-CTGCCATTTACTGCTTGCCA-3’ reverse,5’- TCTACCCAGCTTGGCAGTTG-3’
PSAT1 primer1 forward, 5’-GGGCCACCTTCTTCTGGTTT -3’ reverse,5’- GGGAAACGAGTGAGCTGGAA-3’
PSAT1 primer2 forward, 5’-AGCGGATGCATGAATGGACA-3’ reverse,5’- CACTGGTGTAAGGCGTAGGG -3’
cAMP and cGMP determination Assay
cAMP and cGMP levels in ADSCs were measured using cyclic AMP and GMP XP Assay kit (Cell signaling technology). 7×103 ADSCs were cultured with α-MEM and treated with 50 μM vinpocetine (sigma-aldrich). After 24 h, the cells were rinsed twice with PBS, and lysed with lysis buffer. 50 μl cell lysate with 50 μl of the HRP cAMP solution were added to the cAMP assay plate. Add 100 μl TMB substrate, incubate for 30 minutes, and absorbance were measured at 450 nm using a microplate reader (Bio-Rad) .
Statistical analysis
We used the GraphPad Prism software (v7) to perform statistical analysis. Data were expressed as the mean ± SE. Unless otherwise indicated, differences between two experimental groups were applied using an unpaired two-tailed Student’s t-test. For comparison more than three groups, one way of ANOVA was applied. Results were considered statistically significant with p-values: p<0.01**; p<0.05*.
Results
JMJD6 Is Critical for cellmigration Gene Expression
To investigate the potential roles of histone demethylases which associated with migration of ADSCs, we firstly profiled expression of 27 histone demethylases in ADSCs. RT-PCR assays showed that ADSCs used in our experiments expressed kinds of histone demethylases, including KDM3A, KDM3B, KDM4A, KDM4B, KDM5B, JMJD6, and PHF2 (Figure 1a). Next, we transfected ADSCs with small interfering RNA (siRNA) against 7 histone demethylases or a siRNA control and identify the knockdown efficiency by qRT–PCR (Figure 1b) and the result revealed independent histone demethylases targeted siRNAs reduced the mRNA levels significantly compared to control. In addition, when we examined the invasive ability of the ADSCs depleted for specific histone demethylases along with scramble siRNA transfected cells by migration assays, ADSCs showed a significant increase in migration by about 130±8 cells/field with JMJD6 knockdown, while depleted of KDM3A inhibited process of migration (Figure 1c), demonstrating that JMJD6 knockdown promotes the migration of ADSCs. Therefore, JMJD6 emerged as a top candidate which associated with migration of ADSCs and further studies should focus on JMJD6.
To confirm whether JMJD6 depletion promotes migration of ADSCs and to further determine the underlying mechanism of JMJD6-mediated epigenetic regulation of migration, we utilized three lentivirus-based short hairpin RNAs (shRNA) system to specifically target different sequences on JMJD6 mRNA. As shown in Fig. 2a and 2b, qRT-PCR and western blot assay showed that JMJD6 mRNA and protein levels were reduced by more than 70% in ADSCs cells expressing JMJD6 sh1 and JMJD6 sh3 compared with ADSCs expressing scrambled shRNA. Similar to our results from siRNA-mediated JMJD6 knockdown, ADSCs with JMJD6 stable loss showed a dramatic increase in wound healing ability compared with cells transfected with the control shRNAs (fig. 2b).
JMJD6 Regulates ADSCs proliferation
To determine the role of JMJD6 in the proliferation of ADSCs, JMJD6 sh1 and sh3 stably transduced ADSCs cell line were employed. The proliferation rate of these different cell lines was then measured by CCK8 assay. JMJD6 depletion caused a significant increase in the proliferation rate of ADSCs compared with the control cells (fig. 3a). Similarly, the result of the BrdU labeling assay which is frequently employed as a reliable way to label actively dividing cells, showed that the percentage of BrdU-positive cells display a remarkable increase in ADSCs-JMJD6 sh3 and ADSCs-JMJD6 sh1 compared with control ADSCs-JMJD6 scr (fig. 3b). Given that the depletion of JMJD6 profoundly increased proliferation rate of ADSCs, we then extended our analysis to explore the cell cycle status of ADSCs by assessing their DNA content using PI staining analysis. As shown in fig. 3c, the flow cytometry results showed that the depletion JMJD6 of ADSCs led to a remarkable decrease of cells in G0/G1 phase from 82.4% to 64.6%, which indicate more cells did not maintain the quiescent state. The results also revealed that JMJD6 knock-down promote cell cycle progression into the S phase, number of cells in this phase was significantly elevated from 10.2% to 20.9% compared with the control group. Taken these results together, these results suggest that the depletion of JMJD6 in ADSCs can contribute to cell migration in vitro.
We analyzed the effect of JMJD6 knock-down on cell proliferation and migration
It is known that JMJD6 is a epigenetic regulator, capable of removing methyl group from histone dimethyl symmetric H4R3 (H4R3me2s) which is associated with gene silencing and methyl group from histone dimethyl asymmetric H4R3 (H4R3me2a) which often related to the active gene transcription 15,22. In more detail, JMJD6 is involved in the development of a series of cell functions such as angiogenic sprouting 23, cellular transformation 24, cellular proliferation and motility 25. The biology and underlying mechanism of this arginine demethylase JMJD6 remain debatable and its role in ADSCs still awaits clarified. To identified the changes of gene expression after JMJD6 depletion in ADSCs RNA-seq analysis was conducted. Results showed that after JMJD6 depletion 2941 genes upregulated and 3934 genes downregulated (fig.4a). To further determine the molecular and cellular functions associated with JMJD6 loss, Ingenuity Pathway Analysis (IPA) was performed. The top enriched functions were cell cycle and cellular movement, followed by cellular assembly and organization (Table 1). Heat map showed the expression levels of 20 genes in ADSCs control and JMJD6 depletion determined by RNA-seq. Among the associated gene functions, we selected ITGA8, EGR1, G0S2, CDKN1C, PSAT1, PDE1C, GDF15, VCAM1, and MT1, all of which have been studied related to cellular proliferation and migration, which were further confirmed by using qRT-PCR. Most of genes expressed in JMJD6 loss ADSCs have a higher transcription level than ADSCs control (fig.4c).
JMJD6 Promotes PDE1C Expression in a Demethylase Dependent Manner
Furthermore, we then wanted to determine how JMJD6 facilitated the transactivation of PSAT1 and PDE1C which were most significantly increased two genes in ADSCs cells with JMJD6 loss. PDE1C, namely cyclic nucleotide phosphodiesterases 1C, is usually regarded as a regulator of cyclic hydrolysis both cAMP and cGMP. According to the latest knowledge, PDE1C can modulate the migration of arterial smooth muscle cells (ASMCs) 26 the proliferating of ASMCs 27, endometriosis 28, and Very importantly, PDE1C are critical in the control of glioblastoma growth and migration 29. Therefore, we further explored whether PDE1C might be targeted by JMJD6 to confer the migration and proliferation in ADSCs.
The western blot results showed that JMJD6 depletion led to a global increase of H4R3me2a levels, indicating that JMJD6 is the main H4R3me2a demethylase in ADSCs. The results also revealed that PDE1C expression is regulated by JMJD6 in ADSCs (fig.6a). We next wanted to figure out how JMJD6 epigenetically modulated the expression of PDE1C. ChIP assays showed that JMJD6 bound on the upstream site of PDE1C promoter (fig.5a). As expected, H4R3me2 antibody targeted the same region of PDE1C promoter showed 2.2-fold higher enrichment levels in ADSCs-Scr cells compared with JMJD6-sh3 cells (fig.5b). To validate these observations, we generated three JMJD6 rescue cell lines, including ADSCs-vector, ADSCs-JMJD6-mut, and ADSCs-JMJD6-wt cells. H4R3me2 enrichment levels decreased in ADSCs-JMJD6-wt cells, however remained in ADSCs-vector and ADSCs-JMJD6-mut cells (fig.5d). Consistent with our ChIP assay results, JMJD6 rescue suppressed the enrichment of H4R3me2a on the PDE1C promoter (fig.5e), suggesting that loss of JMJD6 induced increase of PDE1C expression is specifically due to the inhibition of H4R3me2 demethylation at its promoters.
JMJD6 Regulates ADSCs migration and proliferation throughPDE1C
In order to determine whether PDE1C altered due to JMJD6 depletion had any connection with ADSCs migration and proliferation, we employed PDE1C inhibitor vinpocetine to the transwell assays. Consistent with our transwell migration assay results, JMJD6 depletion induced more ADSCs to the lower side of the membrane (fig.6a). After treated with PDE1C inhibitor vinpocetine, the ability of cellular proliferation and motility were significantly attenuated in JMJD6 loss ADSCs (fig.6b and d), indicating that regulation of cellular proliferation and migration by JMJD6 was in some extent partially attribute to the increase of PDE1C expression in JMJD6 depletion ADSCs. PDE1C, known as a phosphodiesterase, which hydrolyzes both cAMP and cGMP to 5′AMP and 5′GMP. As the second messengers, cAMP and cGMP are found to be involved in modulating cellular proliferation and differentiation in various cells, including embryonic stem cells (ESs) 30, dendritic cells (DCs) 31, and epithelial cell 32. To further confirm how the upregulation of PDE1C led to cellular proliferation and migration regulation, we carried out cAMP and cGMP determination assay and analyzed the expression of cAMP and cGMP in ADSCs and JMJD6 depletion ADSCs. The results showed that cAMP and cGMP in ADSCs were 0.948 nM and 0.666 nM, respectively, with the JMJD6 depletion induced upregulation of PDE1C expression, the levels of cAMP and cGMP dramatically raised to JMJD6-sh1 0.461 nM, JMJD6-sh3 0.437 nM, and JMJD6-sh1 0.322 nM, JMJD6-sh3 0.364 nM, respectively (fig.6b). Taken together, JMJD6 depletion ADSCs treated with PDE1C inhibitor vinpocetine, as a consequence of PDE1C inhibition, levels of cAMP and cGMP significantly elevated, which associated with ability of cellular proliferation and motility descent.
Discussion
Recently, studies focusing on ADSCs have gradually shifted from animal models into clinical trials, indicating a promising therapeutic tool of ADSCs 33-35. It has been universally known that the proliferation and motility function of ADSCs is critical for the benefit of stem cells based cytotheapy 36,37. There remains large unknown room and the primary challenge we faced is to determine how those features of ADSCs were regulated. Various molecules and signaling pathways were found to be involved in regulation of ADSCs migration and proliferation, including MCP-1, SDF-1, Wnt, and Jun amino-termanal kinase (JNK) 38,39. Although, regulating those characters of ADSCs is a more complex process that involves multiple genes and mechanisms. Recently studies showed epigenetic mechanisms becoming increasingly important in regulating MSCs self-renew and differentiation 40,41. The present study, we identified JMJD6 as an epigenetic regulator in modulating proliferation and migration of ADSCs by removing methyl group from H4R3me2a on the PDE1C promoter.
JMJD6, also named phosphatidylserine receptor (PTDSR), has been known as a cell-surface protein that engage and mobilize phagocytic cells 42. Lately, JMJD6 was found employs two distinct functions as a histone arginine demethylase and lysyl oxidase 15,43. Through histone demethylases knockdown profile assay, we confirmed JMJD6 as an epigenetic regulate gene associated with cell motility. Furthermore, by using RNA-seq and IPA informatics of JMJD6 depletion ADSCs, we identified JMJD6-regulated genes exhibited enrichment in cell cycle and cell movement functions, which consistent with our findings, shRNA-mediated deletion of JMJD6 in ADSCs promotes cell cycle progression into the S phase and elevates cells ratio undergone proliferation. Not only can JMJD6 repress gene expression through histone demethylation but also activates gene expression. Our ChIP-qPCR results indicated that deletion of JMJD6 promotes PDE1C expression and cell migration via a histone demethylase dependent mechanism. Conversely, restoration of wildtype of JMJD6 expression but JMJD6-mut in ADSCs attenuates H4R3me2a level and the enrichment of H4R3me2a on the PDE1C promote, indicating that JMJD6 demethylase activity is directly related to PDE1C expression. Although strong enrichment of JMJD6 at the promoter of PDE1C promoter, we did not find JMJD6 binding at the promoter of PSAT1 (fig.5c), which could promote cell cycle progression and cell proliferation by inhibition of cyclin D1 degradation 44. Herein, JMJD6 does not regulate expression of PSAT1 by regulating its promoter activity.
As an cyclic nucleotide phosphodiesterases, PDE1C is expressed in a limited number of cell types, including epithelium 45, pancreatic beta-cell 46, VSMC 47 and SMC 26. Interestingly, previously studies shown that PDE1C as a proliferation driving gene that is only expressed in proliferative but not in nonproliferating VSMC and SMC. In addition PDE1C possess an equal ability of hydrolyze both cAMP and cGMP 46, which are intracellular second messengers, their related biological effects are regulated by PDE1C. More importantly, cAMP and cGMP, play strategic role from cellular proliferation to stem cell differentiation 48,49. Notably, maintain an appropriate ratio of cAMP/cGMP is crucial. Enhance intracellular cAMP levels led to the cardiomyocyte differentiation and inhibit of proliferation in ES cells 49. To date, little is known about the role of PDE1C in ADSCs and the specific mechanisms of how PDEC1 is able to regulate proliferate and migrate of ADSCs are poorly understand. In this study, using shRNA induced JMJD6 depletion ADSCs and chemical inhibition of PDE1C vinpocetine, we demonstrated that increase of PDE1C induced by loss of JMJD6, facilities proliferation and migration of ADSCs, which associated with the decline of the levels of both cAMP and cGMP. In contrast, proliferation and migration of ADSCs can be suppressed by applied inhibition of PDE1C vinpocetine and cAMP and cGMP concentration were rescued, suggesting the regulation of PDE1C on proliferation and migration of ADSCs could have been dependent on cAMP and cGMP activities.
In summary, our data indicate that JMJD6 regulates proliferation and migration of ADSCs by demethylating H4R3me2a on promoter regions of PDEC1 and suppressing the PDEC1 expression. Inhibition of PDE1C in ADSCs leads to suppression of the ability of cellular proliferation and motility, validating the cAMP and cGMP are the important downstream signaling molecules of PDE1C. Our work identifies JMJD6 as a key epigenetic regulator of cell function of ADSCs. The regulation between JMJD6, PDE1C and cAMP/cGMP pathway provides possible opportunities to modulate the character of ADSCs to facilitate its clinical applications.
Acknowledgements
We would like to thank Hong Li laboratory for their kind help and excellent technical assistances. This work was supported by the National Natural Science Foundation of China (No.81603478), Natural Science Foundation of Chengdu University of TCM (ZRQN1612), and Educational Commission of Sichuan Province of China (17ZB0149).
Contributions
C.Y.S, Q.Q.L, and H.L. designed the research. C.Y.S and Q.Q.L performed most of the experiments. C.Y performed the bioinformatic analysis. Y.C.W and C.Y.S analyzed the data. C.Y.S, Y.C.W, and H.L. wrote the paper.
Competing Interests
authors have no conflict of interest.
Reference
1 Shen, C. Y. et al. Conditioned medium from umbilical cord mesenchymal stem cells induces migration and angiogenesis. Mol Med Rep 12, 20-30, doi:10.3892/mmr.2015.3409 (2015).
2 Scadden, D. T. The stem-cell niche as an entity of action. Nature 441, 1075-1079, doi:10.1038/nature04957 (2006).
3 Shi, Y. Histone lysine demethylases: emerging roles in development, physiology and disease. Nat Rev Genet 8, 829-833, doi:DOI 10.1038/nrg2218 (2007).
4 Lee, H. L., Yu, B., Deng, P., Wang, C. Y. & Hong, C. Transforming Growth Factor-beta-Induced KDM4B Promotes Chondrogenic Differentiation of Human Mesenchymal Stem Cells. Stem Cells 34, 711-719, doi:10.1002/stem.2231 (2016).
5 Ye, L. et al. Histone Demethylases KDM4B and KDM6B Promote Osteogenic Differentiation of Human MSCs. Cell Stem Cell 11, 50-61, doi:10.1016/j.stem.2012.04.009 (2012).
6 Liu, D. Y. et al. Demethylation of IGFBP5 by Histone Demethylase KDM6B Promotes Mesenchymal Stem Cell-Mediated Periodontal Tissue Regeneration by Enhancing Osteogenic Differentiation and Anti-Inflammation Potentials. Stem Cells 33, 2523-2536, doi:10.1002/stem.2018 (2015).
7 Chen, Y. et al. Histone Demethylase LSD1 Promotes Adipocyte Differentiation through Repressing Wnt Signaling. Cell Chem Biol 23, 1228-1240, doi:10.1016/j.chembiol.2016.08.010 (2016).
8 Rice, C. M. & Scolding, N. J. Adult human mesenchymal cells proliferate and migrate in response to chemokines expressed in demyelination. Cell Adhes Migr 4, 235-240, doi:10.4161/cam.4.2.11404 (2010).
9 Liu, X. L. et al. SDF-1/CXCR4 axis modulates bone marrow mesenchymal stem cell apoptosis, migration and cytokine secretion. Protein Cell 2, 845-854, doi:10.1007/s13238-011-1097-z (2011).
10 Nakanishi, C. et al. Mechanism of Enhanced Migration of Cardiac Progenitor Cells by Bone Marrow-Derived Mesenchymal Stem Cells: Insights from Gene Expression and Secretary Cytokines. J Am Coll Cardiol 57, E1016-E1016, doi:Doi 10.1016/S0735-1097(11)61016-4 (2011).
11 Deng, W. et al. Bone marrow mesenchymal stromal cells with CD47 high expression via the signal transducer and activators of transcription signaling pathway preventing myocardial fibrosis. Int J Clin Exp Patho 8, 10555-10564 (2015).
12 Docheva, D., Popov, C., Mutschler, W. & Schieker, M. Human mesenchymal stem cells in contact with their environment: surface characteristics and the integrin system. J Cell Mol Med 11, 21-38, doi:10.1111/j.1582-4934.2007.00001.x (2007).
13 Li, A. N. et al. PDGF-AA Promotes Osteogenic Differentiation and Migration of Mesenchymal Stem Cell by Down-Regulating PDGFR alpha and Derepressing BMP-Smad1/5/8 Signaling. Plos One 9, doi:ARTN e113785
10.1371/journal.pone.0113785 (2014).
14 Neuss, S., Becher, E., Woltje, M., Tietze, L. & Jahnen-Dechent, W. Functional expression of HGF and HGF receptor/c-met in adult human mesenchymal stem cells suggests a role in cell mobilization, tissue repair, and wound healing. Stem Cells 22, 405-414, doi:DOI 10.1634/stemcells.22-3-405 (2004).
15 Chang, B. S., Chen, Y., Zhao, Y. M. & Bruick, R. K. JMJD6 is a histone arginine demethylase. Science 318, 444-447, doi:10.1126/science.1145801 (2007).
16 Wysocka, J., Allis, C. D. & Coonrod, S. Histone arginine methylation and its dynamic regulation. Front Biosci 11, 344-355, doi:Doi 10.2741/1802 (2006).
17 Li, X. G. et al. H4R3 methylation facilitates beta-globin transcription by regulating histone acetyltransferase binding and H3 acetylation. Blood 115, 2028-2037, doi:10.1182/blood-2009-07-236059 (2010).
18 Yang, Y. Z. et al. TDRD3 Is an Effector Molecule for Arginine-Methylated Histone Marks. Mol Cell 40, 1016-1023, doi:10.1016/j.molcel.2010.11.024 (2010).
19 Chen, Y. et al. Histone Demethylase LSD1 Promotes Adipocyte Differentiation through Repressing Wnt Signaling. Cell Chem Biol 23, 1228-1240, doi:10.1016/j.chembiol.2016.08.010 (2016).
20 Ramadoss, S., Guo, G. & Wang, C. Y. Lysine demethylase KDM3A regulates breast cancer cell invasion and apoptosis by targeting histone and the non-histone protein p53. Oncogene 36, 47-59, doi:10.1038/onc.2016.174 (2017).
21 Ye, L. et al. Histone demethylases KDM4B and KDM6B promotes osteogenic differentiation of human MSCs. Cell Stem Cell 11, 50-61, doi:10.1016/j.stem.2012.04.009 (2012).
22 Xu, X. J., Hoang, S., Mayo, M. W. & Bekiranov, S. Application of machine learning methods to histone methylation ChIP-Seq data reveals H4R3me2 globally represses gene expression. Bmc Bioinformatics 11, doi:Artn 396
10.1186/1471-2105-11-396 (2010).
23 Boeckel, J. N. et al. Jumonji domain-containing protein 6 (Jmjd6) is required for angiogenic sprouting and regulates splicing of VEGF-receptor 1. P Natl Acad Sci USA 108, 3276-3281, doi:10.1073/pnas.1008098108 (2011).
24 Aprelikova, O. et al. The epigenetic modifier JMJD6 is amplified in mammary tumors and cooperates with c-Myc to enhance cellular transformation, tumor progression, and metastasis. Clin Epigenetics 8, doi:ARTN 38
10.1186/s13148-016-0205-6 (2016).
25 Lee, Y. F. et al. JMJD6 is a driver of cellular proliferation and motility and a marker of poor prognosis in breast cancer. Breast Cancer Res 14, doi:ARTN R85
10.1186/bcr3200 (2012).
26 Brzezinska, P. et al. PDE1C regulates the dynamics of actin-based structures in migrating human arterial smooth muscle cells. Faseb J 31 (2017).
27 Rybalkin, S. D. et al. Calmodulin-stimulated cyclic nucleotide phosphodiesterase (PDE1C) is induced in human arterial smooth muscle cells of the synthetic, proliferative phenotype. J Clin Invest 100, 2611-2621, doi:Doi 10.1172/Jci119805 (1997).
28 Ward, K., Chettier, R. & Albertsen, H. M. Replication Study Implicates IL33 and PDE1C as Candidate Genes for Endometriosis. Reprod Sci 23, 246a-247a (2016).
29 Rowther, F. B. et al. Cyclic nucleotide phosphodiesterase-1C (PDE1C) drives cell proliferation, migration and invasion in glioblastoma multiforme cells in vitro. Mol Carcinogen 55, 268-279, doi:10.1002/mc.22276 (2016).
30 Zhu, D. Y. & Lou, Y. J. Icariin-mediated expression of cardiac genes and modulation of nitric oxide signaling pathway during differentiation of mouse embryonic stem cells into cardiomyocytes in vitro. Acta Pharmacol Sin 27, 311-320, doi:10.1111/j.1745-7254.2006.00275.x (2006).
31 Giordano, D., Magaletti, D. M., Clark, E. A. & Beavo, J. A. Cyclic nucleotides promote monocyte differentiation toward a DC-SIGN+ (CD209) intermediate cell and impair differentiation into dendritic cells. J Immunol 171, 6421-6430 (2003).
32 Liu, C. M. et al. cGMP-enhancing- and alpha1A/alpha1D-adrenoceptor blockade-derived inhibition of Rho-kinase by KMUP-1 provides optimal prostate relaxation and epithelial cell anti-proliferation efficacy. Prostate 67, 1397-1410, doi:10.1002/pros.20634 (2007).
33 Aguena, M. et al. Optimization of Parameters for a More Efficient Use of Adipose-Derived Stem Cells in Regenerative Medicine Therapies. Stem Cells Int, doi:Unsp 303610
10.1155/2012/303610 (2012).
34 Dai, R., Wang, Z. J., Samanipour, R., Koo, K. I. & Kim, K. Adipose-Derived Stem Cells for Tissue Engineering and Regenerative Medicine Applications. Stem Cells Int, doi:Artn 6737345
10.1155/2016/6737345 (2016).
35 Kakudo, N., Kushida, S. & Kusumoto, K. Adipose-Derived Stem Cells and Platelet-Rich Plasma: Implications for Regenerative Medicine. Stem Cell Canc Stem 2, 315-321, doi:10.1007/978-94-007-2016-9_34 (2012).
36 Gimble, J. M., Katz, A. J. & Bunnell, B. A. Adipose-derived stem cells for regenerative medicine. Circ Res 100, 1249-1260, doi:10.1161/01.Res.0000265074.83288.09 (2007).
37 Mizuno, H., Tobita, M. & Uysal, A. C. Concise Review: Adipose-Derived Stem Cells as a Novel Tool for Future Regenerative Medicine. Stem Cells 30, 804-810, doi:10.1002/stem.1076 (2012).
38 Cho, H. H. et al. Overexpression of CXCR4 increases migration and proliferation of human adipose tissue stromal cells. Stem Cells Dev 15, 853-864, doi:DOI 10.1089/scd.2006.15.853 (2006).
39 Kang, Y. J. et al. Role of c-jun N-terminal kinase in the PDGF-induced proliferation and migration of human adipose tissue-derived mesenchymal stem cells. J Cell Biochem 95, 1135-1145, doi:10.1002/jcb.20499 (2005).
40 Du, J., Ma, Y. S., Ma, P., Wang, S. L. & Fan, Z. P. Demethylation of Epiregulin Gene by Histone Demethylase FBXL11 and BCL6 Corepressor Inhibits Osteo/dentinogenic Differentiation. Stem Cells 31, 126-136, doi:10.1002/stem.1255 (2013).
41 Xu, J., Yu, B., Hong, C. & Wang, C. Y. KDM6B epigenetically regulates odontogenic differentiation of dental mesenchymal stem cells. Int J Oral Sci 5, 200-205, doi:10.1038/ijos.2013.77 (2013).
42 Fadok, V. A. et al. A receptor for phosphatidylserine-specific clearance of apoptotic cells. Nature 405, 85-90, doi:Doi 10.1038/35011084 (2000).
43 Webby, C. J. et al. Jmjd6 Catalyses Lysyl-Hydroxylation of U2AF65, a Protein Associated with RNA Splicing. Science 325, 90-93, doi:10.1126/science.1175865 (2009).
44 Yang, Y. et al. PSAT1 regulates cyclin D1 degradation and sustains proliferation of non-small cell lung cancer cells. Int J Cancer 136, E39-E50, doi:10.1002/ijc.29150 (2015).
45 Yan, C., Zhao, A. Z., Bentley, J. K. & Beavo, J. A. The calmodulin-dependent phosphodiesterase gene PDE1C encodes several functionally different splice variants in a tissue-specific manner. J Biol Chem 271, 25699-25706 (1996).
46 Han, P., Werber, J., Surana, M., Fleischer, N. & Michaeli, T. The calcium/calmodulin-dependent phosphodiesterase PDE1C down-regulates glucose-induced insulin secretion. Journal of Biological Chemistry 274, 22337-22344, doi:DOI 10.1074/jbc.274.32.22337 (1999).
47 Satoh, K., Kikuchi, N., Kurosawa, R. & Shimokawa, H. PDE1C Negatively Regulates Growth Factor Receptor Degradation and Promotes VSMC Proliferation. Circ Res 116, 1098-1100, doi:10.1161/Circresaha.115.306139 (2015).
48 Lopez-Lluch, G. et al. Inhibition of COX activity by NSAIDs or ascorbate increases cAMP levels and enhances differentiation in 1 alpha,25-dihydroxyvitamin D-3-induced HL-60 cells. Arch Biochem Biophys 436, 32-39, doi:DOI 10.1016/j.abb.2004.12.031 (2005).
49 Zhu, D. Y. & Lou, Y. J. Icariin-mediated expression of cardiac genes and modulation of nitric oxide signaling pathway during differentiation of mouse embryonic stem cells into cardiomyocytes in vitro. Acta Pharmacologica Sinica 27, 311-320, doi:10.1111/j.1745-7254.2006.00275.x (2006).
